Journal articles on the topic 'Washington State Patrol'

Recent celebrated criminal cases have raised the public's awareness of forensic science. The advent of DNA technology, in particular, has led to a perception of instrumental techniques that lead to a mathematical probability of guilt that approaches certainty. Mostly passed over in press accounts of forensic operations is the use of the microscope in the examination of physical evidence. By the use of an example from an adjudicated criminal case it is hoped that a greater appreciation is gained of the microscope, that in its various forms, is by far the most widely used instrument in a crime laboratory today.A middle-aged woman was reported missing by her son after the Memorial Day weekend in 1997. An examination of her apartment by members of the Washington State Patrol Crime Scene Response Team revealed a small amount of blood on her bedding. This bedding, together with other items, was taken into evidence.

Grapevine leafroll disease (GLD) has been recognized as one of the major constraints to the production of wine grapes in Washington State. At least nine distinct Grapevine leafroll-associated viruses (GLRaV-1 to -9) have been detected in grapevines showing GLD symptoms in grape-growing areas of several countries. Previous studies documented the presence of GLRaV-1, -2, and -3 in Washington State (3). We initiated a program to test grapevine cultivars with GLD symptoms for the occurrence of the other GLRaVs. Leaf samples were collected from individual grapevines of red-berried grapevine cultivars showing typical GLD symptoms and tested by single-tube reverse transcription (RT)-PCR. Of nearly 300 samples from 13 cultivars in 19 vineyards, 14 samples from 5 cultivars (Cabernet Sauvignon, Merlot, Pinot Noir, Mourvedre, and Lagrein) in different vineyards tested positive for GLRaV-9 using primers LR9 F/F (5′-CGG CAT AAG AAA AGA TGG CAC-3′) and LR9 R/R (5′-TCA TTC ACC ACT GCT TGA AC-3′), specific for the HSP-70h gene of GLRaV-9 (1). To confirm the identity of the RT-PCR products, the 393-bp amplicons obtained from each of these five cultivars were cloned individually into the pCR2.1 plasmid (Invitrogen Corp., Carlsbad, CA). Two independent clones per amplicon were sequenced from both orientations. Pairwise comparisons of these sequences (GenBank Accession Nos. EF101737, EF101738, EF101739, EF101740, and EU252530) with corresponding sequences of other GLRaVs in GenBank showed 94 to 100 and 96 to 100% identity at the nucleotide and amino acid level, respectively, with the sequence of HSP-70h gene of GLRaV-9 (GenBank Accession No. AY297819). Antiserum specific to GLRaV-9 was not accessible, therefore, an additional 540-nucleotide fragment specific to the coat protein (CP) gene of GLRaV-9 was amplified from cv. Lagrein using primers LR9-CP-F (5′ TAC CGT CGA CAC TTT CGA AGC ACT 3′) and LR9-CP-R (5′ TGA GGC GTC GTA ACC GAA CAA TCT 3′). PCR amplified fragments were cloned and sequenced. A comparison of this sequence (GenBank Accession No. EU251512) with corresponding nucleotide sequences of other GLRaVs in GenBank showed 96% identity with CP of GLRaV-9 (GenBank Accession No. AY297819), further confirming the presence of GLRaV-9. Previously, GLRaV-9 was reported in grapevines in California (1), Tunisia (2), and Western Australia (4). To our knowledge, our results are the first evidence for the occurrence of GLRaV-9 in Washington State vineyards. Results from our study and previous reports (1,2,4) indicate the wide distribution of GLRaV-9 in several Vitis vinifera cultivars. The economic impact of GLRaV-9 on wine grape cultivars, however, remains to be determined. References: (1) R. Alkowni et al. J. Plant Pathol. 86:123, 2004. (2) N. Mahfoudhi et al. Plant Dis. 91:1359, 2007. (3) R. R. Martin et al. Plant Dis. 89:763, 2005. (4) B. K. Peake et al. Aust. Plant Pathol. 33:445, 2004.

Abstract Objective – Washington State University (WSU) Pullman campus librarians track a diverse set of reference statistics to gain a “holistic” look at local reference transaction trends. Our aim was to aggregate virtual, reference desk and office transaction data over the course of three years to determine staffing levels. Specifically, we asked “Where should reference librarians be to answer questions?” Methods – Using Springshare’s LibAnalytics, we generated longitudinal (2012-2014) statistics and data, to help us assess the patterns and trends of patron question numbers, types, communication modes, and locations in the Terrell Library. With this data, we considered current staffing patterns and how we could best address patron needs. Results – Researchers found that compiling data across modalities of location, communication, question type, and the READ Scale led to a better understanding of user behavior trends. Conclusion – Examining and interpreting a more inclusive and richer set of transaction statistics gives reference managers a better picture of how patrons are seeking help, and can serve as a basis for making staffing decisions.

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain ‘37B’, which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3′-untranslated region (3′-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3′-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3′-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Grapevine fanleaf virus (GFLV; genus Nepovirus, family Comoviridae), responsible for fanleaf degeneration disease, is one of the most important viruses of grapevines worldwide (1). During our reconnaissance studies during 2007, dormant wood cuttings from individual grapevines of wine grape cv. Chardonnay were collected randomly from two geographically separate vineyards in eastern Washington State. Extracts made from cambial scrapings of these cuttings were tested separately for different viruses by single-tube reverse transcription (RT)-PCR using virus-specific primers. Two of the thirty-one grapevines in one vineyard tested positive for GLFV as mixed infection with Grapevine leafroll-associated virus (GLRaV)-3. In another vineyard, six of the twenty-six grapevines tested positive for GFLV as mixed infection with GLRaV-1, GLRaV-3, and Grapevine virus A (GVA) A forward primer (5′-ACCGGATTGACGTGGGTGAT, corresponding to nucleotides [nt] 2231–2250) and reverse primer (5′-CCAAAGTTGGTTTCCCAAGA, complementary to nt 2533–2552) specific to RNA-2 of GFLV-F13 isolate (GenBank Accession No. X16907) were used in RT-PCR assays for the detection of GFLV (4). Primers used for RT-PCR detection of GLRaV-1, GLRaV-2, and GVA were described in Martin et al (2) and Minafra et al (3). The RT-PCR results indicated mixed infection of GFLV with GLRaV-1, GLRaV-3, and GVA. To confirm the presence of GFLV, the 322-bp sequence representing a portion of the coat protein encoded by RNA-2 genomic segment was cloned into pCR2.1 (Invitrogen Corp., Carlsbad, CA). Amplicons obtained from six individual grapevines in the two vineyards were used for cloning. Three independent clones per amplicon were sequenced from both orientations. Pairwise comparison of these sequences showed 99 to 100% nucleotide sequence identity among themselves, indicating that GFLV isolates from the two vineyards may be identical. A comparison of the consensus sequence (GenBank Accession No. EU573307) with corresponding sequences of other GFLVs deposited in GenBank showed 89 to 91% identity at the nucleotide level and 95 to 99% identity at the amino acid level. However, mixed infection of GFLV with different viruses in the two vineyards suggests separate introduction of the planting material. ELISA with GFLV-specific antibodies further confirmed the presence of the virus in samples that were positive in RT-PCR. To our knowledge, this is the first report of GFLV in grapevines grown in the Pacific Northwest states of the United States. Further investigations are being carried out on the distribution, symptoms, molecular variability, and nematode vector transmission of GFLV. References: (1) P. Andret-Link et al. J. Plant Pathol. 86:183, 2004. (2) R. R. Martin et al. Plant Dis. 89:763, 2005. (3) A. Minafra et al. Arch. Virol. 142:417, 1997 (4) A. Rowhani et al. Phytopathology 83:749, 1993.

Canola (Brassica napus L) production has gained renewed interest in Washington State over the past few years, primarily for the purpose of producing biofuel. Plants were observed to be showing symptoms of Rhizoctonia root rot and postemergence damping-off. In many cases, this was due to Rhizoctonia solani AG-2-1, which was previously documented (4). However, additional plants were occasionally observed that were stunted and had reduced vigor, but lacked the distinctive severe stem damage and postemergence damping-off, which are both symptoms of infection with R. solani AG-2-1. Isolates of R. solani AG-10 were collected from symptomatic plants or baited from root zone soil at various dryland production locations in eastern Washington, including sites near Colfax, Pullman, and Walla Walla. Initial identification was determined by quantitative (Q)-PCR using R. solani AG-10 specific primers (3). The identity was verified by sequencing random isolates identified by Q-PCR (GenBank Accessions Nos. JQ068147, JQ068148 and JQ068149). All sequenced isolates had 99% identity to previously reported isolates of R. solani AG-10. Six isolates were chosen to test pathogenicity on canola plants in the greenhouse. Sterilized oats were inoculated with each of six isolates of R. solani AG-10 and grown for 4 weeks. The soil was infested with ground oat inoculum (1% wt/wt) and spring canola cv. Sunrise was seeded into 3.8 × 21-cm containers. After 3 weeks of incubation at 15°C, plants were harvested and assessed. Emergence was reduced in the infested soil with 73 to 93% (average 81%) emergence compared with 100% emergence in the noninfested soil. There was no evidence of postemergence damping-off. However, all six isolates of R. solani AG-10 significantly reduced the plant height and top dry weights compared with the noninfested controls. The plant height in infested soil was 28 to 42% (average 34%) shorter and top dry weights were 37 to 70% (average 54%) lower than in noninfested soil. Roots of infected plants had a light brown discoloration along with reduced length and fewer lateral roots. Additional host plants were tested, including wheat (Triticum aestivum L.), barley (Hordeum vulgare L.), pea (Pisum sativum L.), chickpea (Cicer arietinum L.), and lentil (Lens culinaris Medik.). There was no significant reduction in plant height or plant dry weight for any of these hosts. R. solani AG-10 was previously found to be weakly virulent on canola and other cruciferous hosts in Australia (1,2). To our knowledge, this is the first report of R. solani AG-10 causing disease on canola in Washington State. Reference: (1) R. K. Khangura et al. Plant Dis. 83:714, 1999. (2) G. C. MacNish et al. Australas. Plant Pathol. 24:252, 1995. (3) P. A. Okubara et al. Phytopathology 98:837, 2008. (4) T. C. Paulitz et al. Plant Dis. 90:829, 2006.

The choices made by oligarchs and citizens in Dnipropetrovsk during and after the Euromaidan rebellion of 2013–14 were not just event-driven manifestations in response to domestic and internal pressures. They were responses shaped by historically-composed social structures and interrelationships forged over decades within the region, across southeastern Ukraine, and in relation to competing centers of power—in Kyiv, Moscow, Washington, Brussels and beyond. This paper argues that Dnipropetrovsk—and its leaders—played a crucial intermediary role in not only deescalating tensions in southeastern Ukraine more broadly, but also by buttressing the Ukrainian state in a time of existential crisis. In this analysis, oligarchic self-interest is taken as a given and one factor among many, including the signaling of interventionist intent from an external patron and also deeper, regionally specific, economic and structural forces. This piece brings into the analysis a historian’s understanding of contingency, arguing that analyses of developments in southeastern Ukraine (in the past and present) should strive to better situate regional actors not only in space but also time, so as to better understand the complex set of forces and heterogenous social temporalities shaping their choices.

Aerial stem rot of potato (Solanum tuberosum), also known as bacterial stem rot, is often caused by the pectolytic bacteria Pectobacterium (Erwinia) carotovorum subsp. carotovorum, P. atrosepticum, or Dickeya spp. (3). A survey was carried out in August 2008 in ‘Russet Burbank’ potato fields exhibiting aerial stem rot symptoms in the Columbia Basin of Washington State. One bacterial strain isolated during the survey, PwO405, exhibited pectolytic ability on crystal violet pectate (CVP) agar and potato slices and failed to grow at 37°C, but physiological tests did not conclusively distinguish the bacterium as P. atrosepticum (1). The bacterium was positive for ONPG, N-acetylglucosaminyl transferase, gelatin liquefaction, and acid production from D-galactose, lactose, melibiose, raffinose, citrate, and trehalose. The bacterium was negative for indole production and acid production from maltose, α-methyl-D-glucoside, sorbitol, D-arabitol, inositol, inulin, and melezitose. Molecular identification of the bacterium was performed with 16S rRNA, aconitase (acnA), and malate dehydrogenase (mdh) coding sequences as previously described (2,4). Partial sequences of 16S rRNA (1,408 bp) and acnA (412 bp) genes (GenBank Accession Nos. JQ723958 and JQ723959, respectively) exhibited 99% shared identities with P. wasabiae strain WPP163, while the mdh sequence (435 bp) (GenBank Accession No. JQ723960) exhibited 100% shared identity with mdh sequences from three P. wasabiae strains (NZEC9, NZEC10, and NZEC8974). Maximum parsimony analysis using concatenated acnA and mdh sequences from this study and Pectobacterium sequences previously deposited in GenBank (2,4) clustered strain PwO405 with other P. wasabiae strains. Three 7-week-old ‘Russet Norkotah’ potato plants were wound-inoculated by inserting a sterile 23 gauge needle just above a central leaf axil at a depth of 1 mm. A 10-μl drop of inoculum (104 CFU) was placed on the wound. Plants were exposed to a 24-h leaf wetness period (90 to 100% RH in a mist chamber) and lesions were measured. All three inoculated plants exhibited aerial stem rot symptoms similar to those observed in the field, including brown water-soaked lesions that spread acropetally and basipetally. Upon drying, the lesions became shriveled and turned dark brown to black. Some plants exhibited hollowing of the stems and unilateral wilt on the side of the lesion. Symptoms were not observed on water-inoculated controls. The bacteria that were reisolated into pure culture from all three inoculated stems caused pitting on CVP and exhibited the same morphology as the original culture and were confirmed as P. wasabiae using 16S rRNA, acnA, and mdh coding sequences, fulfilling Koch's postulates. Stem rot ability of the bacterium was also confirmed on four potato cultivars: ‘Ranger Russet,’ ‘Russet Burbank,’ ‘Russet Norkotah,’ and ‘Umatilla Russet’ by wound-inoculating six single-stem plants of each cultivar as described above. To our knowledge, this is the first report of aerial stem rot of potato caused by P. wasabiae in Washington State. References: (1) S. De Boer and A. Kelman. Page 56 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. N. Schaad et al., ed. APS Press, St. Paul, 2001. (2) A. Pitman et al. Eur. J. Plant Pathol. 32:211, 2010. (3) M. Powelson and G. Franc. Page 10 in: Compendium of Potato Diseases. W. Stevenson et al., ed. APS Press, St. Paul, 2002. (4) M. Yap et al. Appl. Environ. Microbiol. 70:3013, 2004.

PurposeVirtual reality (VR) is becoming a more available technology including in public spaces like libraries. The value and role of VR as a tool for learning and social engagement are unclear. The purpose of this paper is to explore the ways in which library patrons and librarians perceive VR and experience VR through library drop-in programs.Design/methodology/approachThis paper is based on research conducted in seven Washington State Libraries where VR was adopted for drop-in programming for the first time. Data was collected between March and June 2018 and involved interviews with librarians and patrons, a patron user experience survey, and observational field notes from researchers on site during library programs.FindingsFindings are presented in relation to user perceptions of VR compared to their actual VR experiences, and in relation to informal learning and social engagements. The authors frame the analysis and discussion in relation to sociotechnical imaginaries – culturally situated ideas about the relationship between society and technology, and considering the larger cultural landscape that informs collective views about the present and future.Social implicationsThe paper discusses pending and potential inequalities related to gender, race and class in conversation with technology industry and VR. Issues discussed include unequal access to technology in public libraries and representation of minoritized groups in VR.Originality/valueThis work takes a critical perspective considering the inequities in relation to mainstreaming VR through public spaces like libraries.

Little cherry virus 2 (LChV2; genus Ampelovirus, family Closteroviridae) is associated with Little Cherry Disease (LCD), one of the most economically destructive diseases of sweet cherry (Prunus avium (L.)) in North America (1). Since 2010, incidence of LCD associated with LChV2 confirmed by reverse transcription (RT)-PCR assays has increased in orchards of Washington State. LChV2 was known to be transmitted by the apple mealybug (Phenacoccus aceris (Signoret)) (3). However, the introduction of Allotropus utilis, a parasitoid platygastrid wasp (2) for biological control, contributed to keeping insect populations below the economic threshhold. In recent years, the population of grape mealybug (Pseudococcus maritimus (Ehrhorn)) increased in cherry orchards of Washington State (Beers, personal observation). Since grape mealybug is reported to transmit Grapevine leafroll associated virus 3 (Ampelovirus) in grapevine (4), this study investigated whether this insect would also transmit LChV2. A colony of grape mealybugs on Myrobalan plum (Prunus cerasifera Ehrh.) trees was identified visually and morphologically from slide mounts. In a growth chamber, first and second instar crawlers were fed on fresh cut shoots of sweet cherry infected with a North American strain (LC5) of LChV2. After an acquisition period of 7 days, 50 crawlers were transferred to each young potted sweet cherry trees, cv. Bing, confirmed free from LChV2 by RT-PCR. This process was repeated in two trials to yield a total of 21 potted trees exposed to grape mealybug. One additional tree was left uninfested as a negative control. After 1 week, the trees were treated with pesticide to eliminate the mealybugs. Two to four months after the inoculation period, leaves were collected from each of the recipient trees and tested by RT-PCR for the presence of LChV2. To reduce the possibility of virus contamination from residual mealybug debris on leaf surfaces, the trees were allowed to defoliate naturally. After a 3-month dormant period, the new foliage that emerged was then tested. Two sets of primers: LC26L (GCAGTACGTTCGATAAGAG) and LC26R (AACCACTTGATAGTGTCCT) (1); and LC2.13007F (GTTCGAAAGTGTTTCTTGA) and LC2.14545R (CATTATYTTACTAATGGTATGAC) (this study) were used to amplify a partial segment of the replicase gene (409 bp) and the complete (1,080 bp) coat protein gene of LChV2, respectively. Of 21 trees tested, 18 yielded positive results for LChV2. The reaction products from six randomly selected trees were cloned and the virus identity was verified by sequencing. The sequences of RT-PCR amplicons from both primer pairs showed ≥99% identity to LChV2, strain LC5 (GenBank Accession No. AF416335). The result confirmed that P. maritimus transmits LChV2, a significant finding for this cherry production region. Grape mealybug is of increasing concern in the tree fruit industry because it is difficult to control in established orchards. The presence of infested orchards that serve as reservoirs of both LCD and this insect vector present a challenge for management. To the best of our knowledge this is the first report to show transmission of LChV2 by grape mealybug. References: (1) K. C. Eastwell and M. G. Bernardy. Phytopathology 91:268, 2001. (2) C. F. W. Muesbeck. Can Entomol. 71:158, 1939. (3) J. R. D. Raine et al. Can. J. Plant Pathol. 8:6, 1986. (4) R. Sforza et al. Eur. J. Plant Pathol. 109:975, 2003.

Transportation service level measurements have been commonly used and accepted for highway systems, but similar service measures for ferry systems are less common, especially from the users’ point of view. An approach to measuring ferry route level of service is described that allows comparisons among ferry routes and between ferries and alternate modes such as highways (i.e., drive-around choices) and transit. The recommended approach focuses on excess user waiting times (excess delay) by mode (automobile, registered carpool or vanpool, bus, truck, and walk-on passenger), combined with calibrated relationships between volume-to-capacity (V/C) ratio and user delays for forecasting purposes. Data on waiting times for vehicles in the queues were collected on all ferry routes serviced by Washington State Ferries, and an extensive statistical analysis was performed to compute the relationships between V/C ratios and excess waiting times. Excess delay was defined as the waiting time for missed vessel sailings due to overloads, if any, after a ferry patron has arrived at the dock. User delays were expressed in two forms: absolute number of minutes of waiting time, and the number of boat sailings missed before boarding a ferry. The “boat wait” concept was introduced to differentiate between excess delays caused by congestion that prevents a driver from boarding the next ferry, and delays related to the amount of service provided on a route as reflected in the headways between vessels.

Powdery mildew (Erysiphe polygoni DC [synonym E. betae {Vanha} Weltzien]) of sugar beet (Beta vulgaris L.) has been a significant problem in many sugar beet growing areas of the United States since the first serious epidemic in 1974. Disease has been attributed solely to the asexual stage of the pathogen in the United States, except for one report of the perfect stage in a single field in Washington coincidental with the 1974 epidemic (1). In August 2001, ascomata were observed in several fields in Owyhee County in southwestern Idaho near Grand View. The perfect stage was widespread and easily found, and in one field the surfaces of leaves collected from 50 randomly sampled plants were between 10 and 90% covered with ascomata. Subsequently, the ascigerous stage was found in September and October in multiple fields in three additional counties in southwestern and south-central Idaho and two counties in northern Colorado. Ascomata were found on 12 commercial varieties in the two states and six breeding lines in Colorado. Asci contained one to four hyaline or yellow-to-golden pigmented ascospores per ascus. Ascomata observed in Idaho and Colorado are similar to those described from Europe (2). Ascospores appeared intact after leaves were dried and stored at 4 to 7°C more than 4 weeks. However, after leaves with ascomata were dried and stored at 24 to 27°C for 1 week or more, ascomata and asci appeared intact microscopically, but ascospores were no longer delineated and appeared desiccated or degraded. Because the ascigerous stage provides a means of genetic recombination, there is the potential for races of the pathogen to arise with greater frequency. This has serious implications for managing fungicide resistance and breeding for disease resistance to sugar beet powdery mildew. References: (1) D. L. Coyier et al. (Abstr.) Proc. Am. Phytopathol. Soc. 2:112, 1975. (2) S. Francis. Mol. Plant Pathol. 3:119, 2002.

The author analyzes the structure of the Turkish lobby in the U.S. and main issues of PR and GR support of the Turkey’s interests in Washington. The activities of the Turkish- American Caucus in the Congress and some Turkish- American NGOs are also considered. Sources of primary information are reports for the years 2018–19 of a registered foreign agents in accordance with The Foreign Agents Registration Act, 1938. There are three main directions of lobbying the Turkish interests in the U.S.: • threats related to large- scale economic sanctions for the invasion of Kurdish areas of Syria in 2019; • problems that arise after purchasing the Russia’s C-400 ground-to-air missiles and lead to a discord between NATO allies and Turkey; • Turkey and the U.S. face tough decisions on relations after President Erdogan aims to eliminate preacher Gulen that is hiding in the U.S., and accused by the Turkish authorities of involvement in the attempted coup in Turkey in 2016. There are other issues in Turkish- American relations that are being served by lobbyists: the recognition of the Armenian Genocide, the decision of the Trump’s administration in 2018 to raise import tariffs on Turkish steel and aluminum as well as the White House’s and Turkish opposition blames Erdogan’s regime for violation of human rights and civil freedoms. The author’s conclusion is that the attempts to lobby the Turkish interests with the obvious tensions between Trump and Erdogan have little chance of success. As it is known, Turkey was a political competition tool for the U.S. and USSR in era. But nowadays President Erdogan tries to revise patron- client state relationship with the U. S. Moreover the Turkey’s interests have not been represented by lobbyists in a way that does not contradict the U.S. interests. Only the delivery information to the lawmakers doesn’t guarantee to desirable decisions.

Tomato pith necrosis was observed on 2.7% of tomatoes grown in rows covered with black polyethylene, various biodegradable plastics, and an experimental spunbond poly(lactic) acid agricultural mulch in high tunnel and open field experimental plots, in western Washington in 2011. Symptoms developed on 3-month-old plants and progressed acropetally until night temperatures dropped to 10°C. Affected plants had chlorotic leaves, produced adventitious roots, and pith tissue was brown and either corrugated or rotted. Similar symptoms were observed again in 2012 on 2.0% of plants, but only in experimental plots with black polyethylene mulch. Diseased stem tissue was homogenized with a mortar and pestle in sterile water and the extract was streaked onto King's medium B (KMB) agar. Colonies were white and smooth initially, and after 5 days had an irregular surface and margin and produced a tan diffuse pigment. One isolate, Pc.Sl.2011, was gram-negative, grew at 37°C on nutrient broth yeast (NBY) agar, did not fluoresce on KMB (3), and was arginine dihydrolase positive. A partial 16S fragment, 1,387 bp, was obtained via PCR with universal 27f and 1492f primers. The resulting sequence exhibited 99% identity to Pseudomonas corrugata Roberts & Scarlett, and has been assigned GenBank Accession KC812729. Pathogenicity of Pc.Sl.2011 was tested in two greenhouse trials with five replications of one tomato plant per treatment. Seeds of ‘Celebrity’ were surface sterilized by soaking in 70% EtOH for 30 s and then 10% NaOCl for 30 s, then rinsed with sterile water and sown into 14 cm diameter pots filled with non-sterile Sunshine Mix #1 (SunGro Horticulture Distribution Inc., Bellevue, WA). Seedlings were inoculated at the four leaf stage using 5 ml NBY broth cultures of Pc.Sl.2011 grown at 28°C for 12 h with agitation. A sterile needle was used to inject 10 μl of either sterile water or a bacterial suspension of 1.0 × 1010 CFU/ml into the axil of the second true leaf. Inoculum concentration was confirmed by NBY dilution plate counts. The plants were incubated in clear polyethylene bags for 4 days and placed in a greenhouse at 21.1 ± 1.2°C with a 14-h photoperiod. The first and second trials were sampled at 8 and 9 weeks after inoculation, respectively. Plants inoculated with sterile water had green pith tissue. However, 60 and 40% of inoculated plants had brown pith tissue around the inoculation site in the first and second trial, respectively, but wilting and adventitious roots were not observed. Stem tissue from the inoculation site of symptomatic plants was homogenized as above, and the extract streaked onto NBY agar plates. Three isolates recovered from inoculated plants from both trials had the same characteristics as the original isolate, including similar colony morphology, ability to grow on NBY at 37°C, and lack of fluorescence on KMB. To our knowledge, this is the first documented report of tomato pith necrosis in Washington. Pith necrosis has been reported previously in high tunnel tomato production (4), where excess nitrogen fertilization occurs with cool evening temperatures (3), and when plastic mulch is utilized (2). In the cool climate of western Washington, successful tomato production requires the use of agricultural mulches and covers that trap heat. Since P. corrugata has been isolated from soil and the tomato seeds of inoculated plants (1), local growers attempting to manage pith necrosis need to select tomato seed lots carefully and avoid applying excess nitrogen, especially when using plastic mulch. References: (1) V. Catara. Mol. Plant Pathol. 8:233, 2007. (2) E. J. Sikora and W. S. Gazaway. Online. ACES.edu ANR-0797, 2009. (3) C. M. Scarlett and J. T. Fletcher. Ann. Appl. Biol. 88:105, 1978. (4) X. Xu et al. Plant Dis. 97:988, 2013.

Blackberry chlorotic ringspot virus (BCRV), genus Ilarvirus, has been found in Rubus sp. in Scotland (2) and rose in the United States (4). The possibility that BCRV infects other hosts in the United States was explored. We tested 18 accessions of Fragaria sp. and 30 of Rubus sp. maintained at the National Clonal Germplasm Repository in Corvallis, OR. Ilarviruses had been detected in these plants by reverse transcription (RT)-PCR, ELISA, or had caused symptoms typical of ilarviruses on indicator plants. The accessions were tested by RT-PCR with primers F (5′-GTTTCCTGTGCTCCTCA-3′) and R (5′-GTCACACCGAGGTACT-3′) (4) that amplify a 519 to 522 nt (depending on the isolate) region of the RNA 3 of BCRV. The virus was detected in two accessions of black raspberry (Rubus occidentalis L.): RUB433, cv. Lowden and RUB 9012, cv. New Logan. The sequences of the fragments amplified from these accessions (GenBank Accession Nos. EF041817 and EF041818, respectively) had 97% nt sequence identity to each other and 95 and 88% nt identity to the rose and Scottish isolates (GenBank Accession Nos. DQ329378 and DQ091195, respectively). Chenopodium quinoa indicator plants inoculated with isolate RUB 433 developed mild chlorotic spots on the inoculated leaves 4 days after inoculation. RT-PCR and sequencing of the amplicons verified BCRV infection of C. quinoa. RUB 9012 was used for the characterization of Black raspberry latent virus (BRLV), later thought to be an isolate of Tobacco streak virus (TSV). This accession was recently found to be infected with Strawberry necrotic shock virus (SNSV) but not TSV (3). It is possible that BRLV may be a mixture of SNSV and BCRV. SNSV is one of the most abundant viruses of Rubus sp. in the Pacific Northwest (1), and the finding of another ilarvirus, BCRV, may account in part for the rapid decline of Rubus sp. observed in several fields in Oregon and Washington. To our knowledge, this is the first report of BCRV infecting Rubus sp. outside the United Kingdom. References: (1) A. B. Halgren. Ph.D. Diss. Oregon State University, Corvallis, OR, 2006. (2) A. T. Jones et al. Ann. Appl. Biol. 149:125, 2006. (3) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (4) I. E. Tzanetakis et al. Plant Pathol. 55:568, 2006.

Scabiosa columbaria (Dipsacaceae) is a popular perennial ornamental in the United States. It is native to Europe and was introduced to North America by nursery trade only recently. In the spring of 2006, symptoms of powdery mildew infection were observed on overwintered plants of S. columbaria cv. Butterfly Blue in a nursery in Cutchogue, NY. White powdery mildew mycelia with abundant sporulation were observed on upper and lower leaf surfaces. The portions of leaves with powdery mildew colonies often showed purplish discoloration. Conidia were cylindric to doliiform, measured 20 to 33 × 10 to 15 μm, and were produced singly on 60 to 130 μm long conidiophores consisting of a foot-cell measuring 20 to 50 × 6 to 10 μm, followed by one to three, 12 to 40 μm long cells. Hyphal appressoria were lobed or multilobed. The teleomorph stage was not found. On the basis of these characteristics, the pathogen was identified as an Oidium sp. belonging to the subgenus Pseudoidium. Recently, an anamorphic powdery mildew fungus with similar morphological characteristics, identified as Erysiphe knautiae, was reported on S. columbaria cv. Butterfly Blue in Washington (2). E. knautiae is a common powdery mildew species of dipsacaceous plants such as Scabiosa spp. and Knautia spp. in Europe and Asia (1). To determine whether the fungus reported here was E. knautiae, DNA was extracted from its mycelium, and the internal transcribed spacer (ITS) region of the ribosomal DNA was amplified and sequenced as described earlier (4). No ITS sequences are available in public DNA databases for E. knautiae, thus, we determined this sequence in a specimen of E. knautiae collected from Knautia arvensis in The Netherlands. Herbarium specimens of the Oidium sp. infecting S. columbaria in New York and E. knautiae from the Netherlands were deposited at the U.S. National Fungus Collections under accession numbers BPI 878259 and BPI 878258, respectively. The ITS sequence from Oidium sp. infecting S. columbaria in New York (GenBank Accession No. EU377474) differed in two nucleotides from that of E. knautiae infecting K. arvensis in the Netherlands (GenBank Accession No. EU377475). These two ITS sequences were also more than 99% similar to those of some newly emerged anamorphic powdery mildew fungi: Oidium neolycopersici and other Oidium spp. infecting Chelidonium majus, Passiflora caerulea, and some crassulaceous plants (3,4). Thus, it is unclear whether the fungus reported here was E. knautiae known from Eurasia or an Oidium sp. that has acquired pathogenicity to S. columbaria. To our knowledge, this is the first report of powdery mildew on S. columbaria in New York. References: (1) U. Braun. Beih. Nova Hedwigia 89:1, 1987. (2) D. A. Glawe and G. G. Grove. Online publication. doi:10.1094/PHP-2005-1024-01-BR. Plant Health Progress, 2005. (3) B. Henricot. Plant Pathol. 57:779, 2008. (4) T. Jankovics et al. Phytopathology 98:529, 2008.

Tobacco (Nicotiana tabacum L.) is a leafy, annual, solanaceous plant grown commercially for its leaves. China accounts for more than 39.6% of total global tobacco production (3). In May 2012, seedlings of tobacco cv. Honghuadajinyuan in a Guiyang tobacco commercial field (Guizhou, China, 26.35° N, 106.42° E) developed symptoms of severe wilting, chlorosis, and stunting. The main stem and taproot exhibited reddish to light brown vascular discoloration; further progression of these symptoms eventually caused mortality of infected seedlings. To isolate the causal agent, necrotic tissues from the symptomatic root were placed on potato dextrose agar (PDA) and incubated at 25°C in darkness. Colonies with white to rose mycelia and red-brown colony colors developed on PDA after 5 days of incubation. Microconidia were abundant, straight or slightly curved, clavate, 0- to 3-septate, and 7.5 to 20.0 × 2.5 to 5.0 μm. Macroconidia were straight or slightly curved, slender, 3- to 5-septate, and 25.0 to 45.0 × 3.3 to 5.0 μm. Based on the observed colony attributes, growth patterns, absence of chlamydospores, micro- and macro-spore attributes (1), and PCR amplification (using primers ITS1/4) combined with translation elongation factor primers (EF1/2) (2), the fungus was identified as F. kyushuense O'Donnell & T. Aoki. Sequence of ITS1-5.8s-ITS2 region of rDNA (GenBank Accession No. JX235957) exactly matched the sequences of F. kyushuense accession AB587020.1 (100% similarity). Analysis of the elongation factor (EF-1alpha) gene of the fungus (JX658565) resulted in a 99% match for F. kyushuense accession AB674297.1. Pathogenicity of the fungus was confirmed by performing Koch's postulate as follows. Pure cultures of the fungus F. kyushuense obtained from symptomatic tissues of tobacco seedlings were grown on PDA for 6 days. Tobacco plants to be used in pathogenicity tests were germinated and grown on potting soils in a plastic container. Additional fertilization was supplied by adding 0.2 g/L of 20-20-20 (N-P-K) in the float water. When seedlings got 6-leaf stage, they were ready for pathogenicity tests. Spores harvested from these culture plates were suspended in sterile distilled water, adjusted to a concentration of 1 × 104 conidia/ml, and inoculated by irrigating 10 ml of the conidia suspension onto roots of each of the 12 tobacco seedlings with 6-leaf stage. A group of 12 seedlings of the same age treated with sterile water served as control. Inoculated seedlings were maintained at 25°C, 100 μE m–2.s–1, relative humidity >70%, and 16 h light per day, and monitored for 9 days for symptom development. Seedlings inoculated with conidia developed disease symptoms with roots with vascular discoloration of roots whereas control seedlings remained symptomless. F. kyushuense was reisolated from the symptomatic seedlings 9 days after inoculation. F. kyushuense has also been isolated from rice seeds in China (4), and from diseased wheat in Japan (1). The common tobacco Fusarium disease reported in China was caused by F. oxysporium f. sp. nicotianae. However, to the best of our knowledge, this is the first report of F. kyushuense causing wilt on tobacco in China and the disease must be considered in existing disease management practices. References: (1) T. Aoki and K. O'Donnell. Mycoscience. 39:1, 1998. (2) D. M. Geiser et al. Eur. J. Plant Pathol. 110:473, 2004. (3) US Census Bureau. Foreign Trade Statistics. Washington DC, 2005. (4) Z. H. Zhao and G. Z. Lu. Mycotaxon. 102:119, 2007.

Platanus occidentalis L. (sycamore) is an important shade tree distributed throughout the Northern Hemisphere and in South Korea. It has been widely used as an ornamental tree, especially in urban regions and by roadsides. The average rate of roadside planting throughout South Korea covers about 5.7% (up to 38% in Seoul), equivalent to 0.36 million trees. In early July 2012, after a rainy spell in summer, an outbreak of powdery mildew on sycamore was first observed on roadside trees in Gwangju, a southern province of South Korea. A more extensive nationwide survey revealed no powdery mildew in northern or central regions of South Korea. The disease has spread rapidly within Gwangju, even though fungicide applications were carried out after the rainy spell. Major symptoms included white, superficial mycelia, grey to brown lesions on the surface of the leaves due to the presence of a hyperparasite (tentatively identified as Ampelomyces sp.), a slight chlorosis, and severe leaf distortion followed by defoliation. Conidiophores were produced singly, straight, and unbranched, with lengths of 35.2 to 315.2 μm (average 170.4 μm). Conidia were ellipsoid or doliiform, ranging in size from 34.9 to 47.4 μm (average 38.2 μm) long × 16.5 to 26.8 μm (average 23.9 μm) wide. Primary conidia had a truncate base and rounded apex; secondary conidia had both a truncate base and apex. The conidial outer surface had a reticulated wrinkling. Cleistothecia (i.e., sexual spore structures) were not found during the survey, which extended from July to October. These characteristics and the host species match those of Microsphaera platani (syn. Erysiphe platani), which was described on P. occidentalis in Washington State (2). Fungal rDNA was amplified using primers ITS1 and LR5F (4) for one sample (EML-PLA1, GenBank JX485651). BLASTn searches of GenBank revealed high sequence identity to E. platani (99.5% to JQ365943 and 99.3% to JQ365940). Recently, Liang et al. (3) reported the first occurrence of powdery mildew by E. platani on P. orientalis in China based only on its morphology. Thus, in this study, author could only use ITS sequence data from the United States and Europe to characterize the isolate. To date, nine records of powdery mildews of Platanus spp. have been reported worldwide: on P. hispanica from Brazil, Japan, Hungary, and Slovakia; P. orientalis from Israel; P. racemosa from the United States; P. × acerifolia from the United Kingdom and Germany; and Platanus sp. from Argentina and Australia (1). Interestingly, the hyperparasite, Ampelomyces sp., was found with E. platani, suggesting that there may be some level of biocontrol in nature. Pathogenicity was confirmed by gently pressing diseased leaves onto six leaves of healthy sycamore plants in the field in September. The treated leaves were sealed in sterilized vinyl pack to maintain humid condition for 2 days. Similar symptoms were observed on the inoculated leaves 10 days after inoculation. Koch's postulates were fulfilled by re-observing the fungal pathogen. To our knowledge, this is the first report of powdery mildew caused by E. platani on sycamore in South Korea. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. http://nt.ars-grin.gov/fungaldatabases/ , 2012. (2) D. A. Glawe. Plant Health Progress, doi:10.1094/PHP-2003-0818-01-HN, 2003. (3) C. Liang et al. Plant Pathol. 57:375, 2008. (4) T. J White et al., pp. 315-322 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., ed. Academic Press, New York, 1990.

In the Dominican Republic, green bell pepper (Capsicum annuum L.) and tomato (Solanum lycopersicum L.) are widely cultivated under protected greenhouse conditions as high value commercial crops for export. For the past 2 to 3 years, pepper and tomato have been observed in protected crop facilities in Jarabacoa and Constanza in the North Region with chlorotic and necrotic spots and rings on leaves, petioles, and stems, leaf bronzing, and tip necrosis. Fruits on symptomatic pepper and tomato plants showed concentric rings, irregular chlorotic blotches and deformation, and uneven maturation and development. Incidence on pepper and tomato was 20 to 100% and 5 to 20%, respectively. In initial tests, leaves and fruits from each of 20 symptomatic tomato and pepper plants from several greenhouse facilities were reactive in Tomato spotted wilt virus (TSWV; genus Tospovirus, family Bunyaviridae) immunostrip assays (Agdia, Inc., Elkhart, IN). Since these immunostrips are known to react with other tospoviruses, such as Tomato chlorotic spot virus (TCSV) and Groundnut ring spot virus, additional molecular diagnostic assays were conducted. Leaf and fruit samples from symptomatic plants were imprinted on nitrocellulose membrane (NCM) (2), air-dried, and sent to Washington State University for confirmatory tests. Viral nucleic acids were eluted from NCM discs (1) and subjected to reverse transcription (RT)-PCR using primers gL3637 (CCTTTAACAGTDGAAACAT) and gL4435 (CATDGCRCAAGARTGRTARACAGA) designed to amplify a portion of the L RNA segment of several tospoviruses (3). A single DNA product of ~800 bp was amplified from all samples. Amplicons from two tomato (leaf and fruit) and one pepper fruit samples were cloned separately into pCR2.1 (Invitrogen Corp., Carlsbad, CA). Two independent clones per amplicon were sequenced in both orientations. Sequence analyses of these clones (GenBank Accession Nos. KF 219673 to 75) showed 100% nucleotide sequence identity among themselves and 97% identity with corresponding L RNA sequences of pepper isolates of TSWV from Taiwan (HM180088) and South Korea (HM581940), 94 to 95% with tomato isolates of TSWV from South Korea (HM581934) and Hawaii (AY070218), and 89% with a tomato isolate from Indonesia (FJ177301). These results further confirm the presence of TSWV in symptomatic tomato and pepper plants. A comparison of TSWV sequences from the Dominican Republic with TSWV isolates from the United States and other countries in the Caribbean region could not be made due to the absence of corresponding sequences of the L-RNA of the virus from these countries in GenBank. TSWV-positive samples were negative for TCSV in RT-PCR, indicating the absence of this tospovirus that has been reported in the Caribbean region (data not shown). To our knowledge, this is the first confirmed report of TSWV in tomatoes and peppers in the Dominican Republic. The presence of vector thrips, Frankliniella occidentalis, on symptomatic plants was also confirmed, suggesting a role in the spread of TSWV under greenhouse conditions. Recent surveys identified some greenhouses with 100% symptomatic peppers. The presence of TSWV in tomato and pepper has important implications for the domestic and export vegetable industry in the Dominican Republic because of the broad host range of the virus (4). It is critical for commercial producers to monitor TSWV and deploy appropriate management strategies to limit virus spread. References: (1) O. J. Alabi et al. J. Virol. Methods 154:111, 2008. (2) P.-G. S. Chang et al. J. Virol. Methods 171:345, 2011. (3) F. H. Chu et al. Phytopathology 91:361, 2001. (4) G. Parrella et al. J. Plant Pathol. 85:227, 2003.

JVWR Assembled 2020 presents our final contribution to a focused effort within the capacity of Virtual Worlds. This issue includes three articles covering 360 audio technologies, instructional use, and the topic of purchase intentions in Virtual Worlds. The issue is led by devoted research partners who have worked together previously. Dr. Angie Cox, Professor of Business Technology and Process Improvement & Professor at the Air Force Institute of Technology, acts as the prime editor. Dr. Ryan Durbin, at the Washington State Patrol, and Dr. Vernell Hall, of Trident American Intercontinental University, act as the co-editors.

Image 1: “Oklahoma State Highway Re-imagined.” CC BY-SA 4.0 2015 by author, using Wikimedia image by Ks0stm (CC BY-SA 3 2013). Introduction This article is divided in three major parts. First a scenario, second its context, and third, an analysis. The text draws on ethnographic research on security practices in the United States among police and parts of the intelligence community from 2006 through to the beginning of 2014. Real names are used when the material is drawn from archival sources, while individuals who were interviewed during fieldwork are referred to by their position rank or title. For matters of fact not otherwise referenced, see the sources compiled on “The Complete 911 Timeline” at History Commons. First, a scenario. Oklahoma, 2001 It is 1 April 2001, in far western Oklahoma, warm beneath the late afternoon sun. Highway Patrol Trooper C.L. Parkins is about 80 kilometres from the border of Texas, watching trucks and cars speed along Interstate 40. The speed limit is around 110 kilometres per hour, and just then, his radar clocks a blue Toyota Corolla going 135 kph. The driver is not wearing a seatbelt. Trooper Parkins swung in behind the vehicle, and after a while signalled that the car should pull over. The driver was dark-haired and short; in Parkins’s memory, he spoke English without any problem. He asked the man to come sit in the patrol car while he did a series of routine checks—to see if the vehicle was stolen, if there were warrants out for his arrest, if his license was valid. Parkins said, “I visited with him a little bit but I just barely remember even having him in my car. You stop so many people that if […] you don't arrest them or anything […] you don't remember too much after a couple months” (Clay and Ellis). Nawaf Al Hazmi had a valid California driver’s license, with an address in San Diego, and the car’s registration had been legally transferred to him by his former roommate. Parkins’s inquiries to the National Crime Information Center returned no warnings, nor did anything seem odd in their interaction. So the officer wrote Al Hazmi two tickets totalling $138, one for speeding and one for failure to use a seat belt, and told him to be on his way. Al Hazmi, for his part, was crossing the country to a new apartment in a Virginia suburb of Washington, DC, and upon arrival he mailed the payment for his tickets to the county court clerk in Oklahoma. Over the next five months, he lived several places on the East Coast: going to the gym, making routine purchases, and taking a few trips that included Las Vegas and Florida. He had a couple more encounters with local law enforcement and these too were unremarkable. On 1 May 2001 he was mugged, and promptly notified the police, who documented the incident with his name and local address (Federal Bureau of Investigation, 139). At the end of June, having moved to New Jersey, he was involved in a minor traffic accident on the George Washington Bridge, and officers again recorded his real name and details of the incident. In July, Khalid Al Mihdhar, the previous owner of the car, returned from abroad, and joined Al Hazmi in New Jersey. The two were boyhood friends, and they went together to a library several times to look up travel information, and then, with Al Hazmi’s younger brother Selem, to book their final flight. On 11 September, the three boarded American Airlines flight 77 as part of the Al Qaeda team that flew the mid-sized jet into the west façade of the Pentagon. They died along with the piloting hijacker, all the passengers, and 125 people on the ground. Theirs was one of four airplanes hijacked that day, one of which was crashed by passengers, the others into significant sites of American power, by men who had been living for varying lengths of time all but unnoticed in the United States. No one thought that Trooper Parkins, or the other officers with whom the 9/11 hijackers crossed paths, should have acted differently. The Commissioner of the Oklahoma Department of Public Safety himself commented that the trooper “did the right thing” at that April traffic stop. And yet, interviewed by a local newspaper in January of 2002, Parkins mused to the reporter “it's difficult sometimes to think back and go: 'What if you had known something else?'" (Clay and Ellis). Missed Opportunities Image 2: “Hijackers Timeline (Redacted).” CC BY-SA 4.0 2015 by author, using the Federal Bureau of Investigation (FBI)’s “Working Draft Chronology of Events for Hijackers and Associates”. In fact, several of the men who would become the 9/11 hijackers were stopped for minor traffic violations. Mohamed Atta, usually pointed to as the ringleader, was given a citation in Florida that spring of 2001 for driving without a license. When he missed his court date, a bench warrant was issued (Wall Street Journal). Perhaps the warrant was not flagged properly, however, since nothing happened when he was pulled over again, for speeding. In the government inquiries that followed attack, and in the press, these brushes with the law were “missed opportunities” to thwart the 9/11 plot (Kean and Hamilton, Report 353). Among a certain set of career law enforcement personnel, particularly those active in management and police associations, these missed opportunities were fraught with a sense of personal failure. Yet, in short order, they were to become a source of professional revelation. The scenarios—Trooper Parkins and Al Hazmi, other encounters in other states, the general fact that there had been chance meetings between police officers and the hijackers—were re-imagined in the aftermath of 9/11. Those moments were returned to and reversed, so that multiple potentialities could be seen, beyond or in addition to what had taken place. The deputy director of an intelligence fusion centre told me in an interview, “it is always a local cop who saw something” and he replayed how the incidents of contact had unfolded with the men. These scenarios offered a way to recapture the past. In the uncertainty of every encounter, whether a traffic stop or questioning someone taking photos of a landmark (and potential terrorist target), was also potential. Through a process of re-imagining, police encounters with the public became part of the government’s “national intelligence” strategy. Previously a division had been marked between foreign and domestic intelligence. While the phrase “national intelligence” had long been used, notably in National Intelligence Estimates, after 9/11 it became more significant. The overall director of the US intelligence community became the Director National Intelligence, for instance, and the cohesive term marked the way that increasingly diverse institutional components, types of data and forms of action were evolving to address the collection of data and intelligence production (McConnell). In a series of working groups mobilised by members of major police professional organisations, and funded by the US Department of Justice, career officers and representatives from federal agencies produced detailed recommendations and plans for involving police in the new Information Sharing Environment. Among the plans drawn up during this period was what would eventually come to be the Nationwide Suspicious Activity Reporting Initiative, built principally around the idea of encounters such as the one between Parkins and Al Hazmi. Map 1: Map of pilot sites in the Nationwide Suspicious Activity Reporting Evaluation Environment in 2010 (courtesy of the author; no longer available online). Map 2: Map of participating sites in the Nationwide Suspicious Activity Reporting Initiative, as of 2014. In an interview, a fusion centre director who participated in this planning as well as its implementation, told me that his thought had been, “if we train state and local cops to understand pre-terrorism indicators, if we train them to be more curious, and to question more what they see,” this could feed into “a system where they could actually get that information to somebody where it matters.” In devising the reporting initiative, the working groups counter-actualised the scenarios of those encounters, and the kinds of larger plots to which they were understood to belong, in order to extract a set of concepts: categories of suspicious “activities” or “patterns of behaviour” corresponding to the phases of a terrorism event in the process of becoming (Deleuze, Negotiations). This conceptualisation of terrorism was standardised, so that it could be taught, and applied, in discerning and documenting the incidents comprising an event’s phases. In police officer training, the various suspicious behaviours were called “terrorism precursor activities” and were divided between criminal and non-criminal. “Functional Standards,” developed by the Los Angeles Police Department and then tested by the Department of Homeland Security (DHS), served to code the observed behaviours for sharing (via compatible communication protocols) up the federal hierarchy and also horizontally between states and regions. In the popular parlance of videos made for the public by local police departments and DHS, which would come to populate the internet within a few years, these categories were “signs of terrorism,” more specifically: surveillance, eliciting information, testing security, and so on. Image 3: “The Seven Signs of Terrorism (sometimes eight).” CC BY-SA 4.0 2015 by author, using materials in the public domain. If the problem of 9/11 had been that the men who would become hijackers had gone unnoticed, the basic idea of the Suspicious Activity Reporting Initiative was to create a mechanism through which the eyes and ears of everyone could contribute to their detection. In this vein, “If You See Something, Say Something™” was a campaign that originated with the New York City Metropolitan Transportation Authority, and was then licensed for use to DHS. The tips and leads such campaigns generated, together with the reports from officers on suspicious incidents that might have to do with terrorism, were coordinated in the Information Sharing Environment. Drawing on reports thus generated, the Federal Government would, in theory, communicate timely information on security threats to law enforcement so that they would be better able to discern the incidents to be reported. The cycle aimed to catch events in emergence, in a distinctively anticipatory strategy of counterterrorism (Stalcup). Re-imagination A curious fact emerges from this history, and it is key to understanding how this initiative developed. That is, there was nothing suspicious in the encounters. The soon-to-be terrorists’ licenses were up-to-date, the cars were legal, they were not nervous. Even Mohamed Atta’s warrant would have resulted in nothing more than a fine. It is not self-evident, given these facts, how a governmental technology came to be designed from these scenarios. How––if nothing seemed of immediate concern, if there had been nothing suspicious to discern––did an intelligence strategy come to be assembled around such encounters? Evidently, strident demands were made after the events of 9/11 to know, “what went wrong?” Policies were crafted and implemented according to the answers given: it was too easy to obtain identification, or to enter and stay in the country, or to buy airplane tickets and fly. But the trooper’s question, the reader will recall, was somewhat different. He had said, “It’s difficult sometimes to think back and go: ‘What if you had known something else?’” To ask “what if you had known something else?” is also to ask what else might have been. Janet Roitman shows that identifying a crisis tends to implicate precisely the question of what went wrong. Crisis, and its critique, take up history as a series of right and wrong turns, bad choices made between existing dichotomies (90): liberty-security, security-privacy, ordinary-suspicious. It is to say, what were the possibilities and how could we have selected the correct one? Such questions seek to retrospectively uncover latencies—systemic or structural, human error or a moral lapse (71)—but they ask of those latencies what false understanding of the enemy, of threat, of priorities, allowed a terrible thing to happen. “What if…?” instead turns to the virtuality hidden in history, through which missed opportunities can be re-imagined. Image 4: “The Cholmondeley Sisters and Their Swaddled Babies.” Anonymous, c. 1600-1610 (British School, 17th century); Deleuze and Parnet (150). CC BY-SA 4.0 2015 by author, using materials in the public domain. Gilles Deleuze, speaking with Claire Parnet, says, “memory is not an actual image which forms after the object has been perceived, but a virtual image coexisting with the actual perception of the object” (150). Re-imagined scenarios take up the potential of memory, so that as the trooper’s traffic stop was revisited, it also became a way of imagining what else might have been. As Immanuel Kant, among others, points out, “the productive power of imagination is […] not exactly creative, for it is not capable of producing a sense representation that was never given to our faculty of sense; one can always furnish evidence of the material of its ideas” (61). The “memory” of these encounters provided the material for re-imagining them, and thereby re-virtualising history. This was different than other governmental responses, such as examining past events in order to assess the probable risk of their repetition, or drawing on past events to imagine future scenarios, for use in exercises that identify vulnerabilities and remedy deficiencies (Anderson). Re-imagining scenarios of police-hijacker encounters through the question of “what if?” evoked what Erin Manning calls “a certain array of recognizable elastic points” (39), through which options for other movements were invented. The Suspicious Activity Reporting Initiative’s architects instrumentalised such moments as they designed new governmental entities and programs to anticipate terrorism. For each element of the encounter, an aspect of the initiative was developed: training, functional standards, a way to (hypothetically) get real-time information about threats. Suspicion was identified as a key affect, one which, if cultivated, could offer a way to effectively deal not with binary right or wrong possibilities, but with the potential which lies nestled in uncertainty. The “signs of terrorism” (that is, categories of “terrorism precursor activities”) served to maximise receptivity to encounters. Indeed, it can apparently create an oversensitivity, manifested, for example, in police surveillance of innocent people exercising their right to assemble (Madigan), or the confiscation of photographers’s equipment (Simon). “What went wrong?” and “what if?” were different interrogations of the same pre-9/11 incidents. The questions are of course intimately related. Moments where something went wrong are when one is likely to ask, what else might have been known? Moreover, what else might have been? The answers to each question informed and shaped the other, as re-imagined scenarios became the means of extracting categories of suspicious activities and patterns of behaviour that comprise the phases of an event in becoming. Conclusion The 9/11 Commission, after two years of investigation into the causes of the disastrous day, reported that “the most important failure was one of imagination” (Kean and Hamilton, Summary). The iconic images of 9/11––such as airplanes being flown into symbols of American power––already existed, in guises ranging from fictive thrillers to the infamous FBI field memo sent to headquarters on Arab men learning to fly, but not land. In 1974 there had already been an actual (failed) attempt to steal a plane and kill the president by crashing it into the White House (Kean and Hamilton, Report Ch11 n21). The threats had been imagined, as Pat O’Malley and Philip Bougen put it, but not how to govern them, and because the ways to address those threats had been not imagined, they were discounted as matters for intervention (29). O’Malley and Bougen argue that one effect of 9/11, and the general rise of incalculable insecurities, was to make it necessary for the “merely imaginable” to become governable. Images of threats from the mundane to the extreme had to be conjured, and then imagination applied again, to devise ways to render them amenable to calculation, minimisation or elimination. In the words of the 9/11 Commission, the Government must bureaucratise imagination. There is a sense in which this led to more of the same. Re-imagining the early encounters reinforced expectations for officers to do what they already do, that is, to be on the lookout for suspicious behaviours. Yet, the images of threat brought forth, in their mixing of memory and an elastic “almost,” generated their own momentum and distinctive demands. Existing capacities, such as suspicion, were re-shaped and elaborated into specific forms of security governance. The question of “what if?” and the scenarios of police-hijacker encounter were particularly potent equipment for this re-imagining of history and its re-virtualisation. References Anderson, Ben. “Preemption, Precaution, Preparedness: Anticipatory Action and Future Geographies.” Progress in Human Geography 34.6 (2010): 777-98. Clay, Nolan, and Randy Ellis. “Terrorist Ticketed Last Year on I-40.” NewsOK, 20 Jan. 2002. 25 Nov. 2014 ‹http://newsok.com/article/2779124›. Deleuze, Gilles. Negotiations. New York: Columbia UP, 1995. Deleuze, Gilles, and Claire Parnet. Dialogues II. New York: Columbia UP 2007 [1977]. Federal Bureau of Investigation. “Hijackers Timeline (Redacted) Part 01 of 02.” Working Draft Chronology of Events for Hijackers and Associates. 2003. 18 Apr. 2014 ‹https://vault.fbi.gov/9-11%20Commission%20Report/9-11-chronology-part-01-of-02›. Kant, Immanuel. Anthropology from a Pragmatic Point of View. Trans. Robert B. Louden. Cambridge: Cambridge UP, 2006. Kean, Thomas H., and Lee Hamilton. Executive Summary of the 9/11 Commission Report: Final Report of the National Commission on Terrorist Attacks upon the United States. 25 Oct. 2015 ‹http://www.9-11commission.gov/report/911Report_Exec.htm›. Kean, Thomas H., and Lee Hamilton. The 9/11 Commission Report: Final Report of the National Commission on Terrorist Attacks upon the United States. New York: W.W. Norton, 2004. McConnell, Mike. “Overhauling Intelligence.” Foreign Affairs, July/Aug. 2007. Madigan, Nick. “Spying Uncovered.” Baltimore Sun 18 Jul. 2008. 25 Oct. 2015 ‹http://www.baltimoresun.com/news/maryland/bal-te.md.spy18jul18-story.html›. Manning, Erin. Relationscapes: Movement, Art, Philosophy. Cambridge, MA: MIT P, 2009. O’Malley, P., and P. Bougen. “Imaginable Insecurities: Imagination, Routinisation and the Government of Uncertainty post 9/11.” Imaginary Penalities. Ed. Pat Carlen. Cullompton, UK: Willan, 2008.Roitman, Janet. Anti-Crisis. Durham, NC: Duke UP, 2013. Simon, Stephanie. “Suspicious Encounters: Ordinary Preemption and the Securitization of Photography.” Security Dialogue 43.2 (2012): 157-73. Stalcup, Meg. “Policing Uncertainty: On Suspicious Activity Reporting.” Modes of Uncertainty: Anthropological Cases. Eds. Limor Saminian-Darash and Paul Rabinow. Chicago: U of Chicago P, 2015. 69-87. Wall Street Journal. “A Careful Sequence of Mundane Dealings Sows a Day of Bloody Terror for Hijackers.” 16 Oct. 2001.

IntroductionAccounts of criminals, their victims, and their pursuers have become entrenched within the sphere of popular culture; most obviously in the genres of true crime and crime fiction. The centrality of the pursuer in the form of the detective, within these stories, dates back to the nineteenth century. This, often highly-stylised and regularly humanised protagonist, is now a firm feature of both factual and fictional accounts of crime narratives that, today, regularly focus on the energies of the detective in solving a variety of cases. So familiar is the figure of the detective, it seems that these men and women—amateurs and professionals—have always had an important role to play in the pursuit and punishment of the wrongdoer. Yet, the first detectives were forced to overcome significant resistance from a suspicious public. Some early efforts to reimagine punishment and to laud the detective include articles written by Charles Dickens; pieces on public hangings and policing that reflect the great Victorian novelist’s commitment to shed light on, through written commentaries, a range of important social issues. This article explores some of Dickens’s lesser-known pieces, that—appearing in daily newspapers and in one of his own publications Household Words—helped to change some common perceptions of punishment and policing. Image 1: Harper's Magazine 7 December 1867 (Charles Dickens Reading, by Charles A. Barry). Image credit: United States Library of Congress Prints and Photographs Division. A Reliance on the Scaffold: Early Law Enforcement in EnglandCrime control in 1720s England was dependent upon an inconsistent, and by extension ineffective, network of constables and night watchmen. It would be almost another three decades before Henry Fielding established the Bow Street Foot Patrol, or Bow Street Runners, in 1749, “six men in blue coats, patrolling the area within six miles of Charing Cross” (Worsley 35). A large-scale, formalised police force was attempted by Pitt the Younger in 1785 with his “Bill for the Further prevention of Crime and for the more Speedy Detection and Punishment of Offenders against the Peace” (Lyman 144). The proposed legislation was withdrawn due to fierce opposition that was underpinned by fears, held by officials, of a divestment of power to a new body of law enforcers (Lyman 144).The type of force offered in 1785 would not be realised until the next century, when the work of Robert Peel saw the passing of the Metropolitan Police Act 1829. The Police Act, which “constituted a revolution in traditional methods of law enforcement” (Lyman 141), was focused on the prevention of crime, “to reassure the lawful and discourage the wrongdoer” (Hitchens 51). Until these changes were implemented violent punishment, through the Waltham Black Act 1723, remained firmly in place (Cruickshanks and Erskine-Hill 359) as part of the state’s arsenal against crime (Pepper 473).The Black Act, legislation often referred to as the ‘Bloody Code’ as it took the number of capital felonies to over 350 (Pepper 473), served in lieu of consistency and cooperation, across the country, in relation to the safekeeping of the citizenry. This situation inevitably led to anxieties about crime and crime control. In 1797 Patrick Colquhoun, a magistrate, published A Treatise on the Police of the Metropolis in which he estimated that, out of a city population of just under 1 million, 115,000 men and women supported themselves “in and near the Metropolis by pursuits either criminal-illegal-or immoral” (Lyman 144). Andrew Pepper highlights tensions between “crime, governance and economics” as well as “rampant petty criminality [… and] widespread political corruption” (474). He also notes a range of critical responses to crime and how, “a particular kind of writing about crime in the 1720s demonstrated, perhaps for the first time, an awareness of, or self-consciousness about, this tension between competing visions of the state and state power” (Pepper 474), a tension that remains visible today in modern works of true crime and crime fiction. In Dickens’s day, crime and its consequences were serious legal, moral, and social issues (as, indeed, they are today). An increase in the crime rate, an aggressive state, the lack of formal policing, the growth of the printing industry, and writers offering diverse opinions—from the sympathetic to the retributive—on crime changed crime writing. The public wanted to know about the criminal who had disturbed society and wanted to engage with opinions on how the criminal should be stopped and punished. The public also wanted to be updated on changes to the judicial system such as the passing of the Judgement of Death Act 1823 which drastically reduced the number of capital crimes (Worsley 122) and how the Gaols Act, also of 1823, “moved tentatively towards national prison reform” (Gattrell 579). Crimes continued to be committed and alongside the wrongdoers were readers that wanted to be diverted from everyday events by, but also had a genuine need to be informed about, crime. A demand for true crime tales demonstrating a broader social need for crimes, even the most minor infractions, to be publicly punished: first on the scaffold and then in print. Some cases were presented as sensationalised true crime tales; others would be fictionalised in short stories and novels. Standing Witness: Dickens at the ScaffoldIt is interesting to note that Dickens witnessed at least four executions in his lifetime (Simpson 126). The first was the hanging of a counterfeiter, more specifically a coiner, which in the 1800s was still a form of high treason. The last person executed for coining in England was in early 1829; as Dickens arrived in London at the end of 1822, aged just 10-years-old (Simpson 126-27) he would have been a boy when he joined the crowds around the scaffold. Many journalists and writers who have documented executions have been “criticised for using this spectacle as a source for generating sensational copy” (Simpson 127). Dickens also wrote about public hangings. His most significant commentaries on the issue being two sets of letters: one set published in The Daily News (1846) and a second set published in The Times (1849) (Brandwood 3). Yet, he was immune from the criticism directed at so many other writers, in large part, due to his reputation as a liberal, “social reformer moved by compassion, but also by an antipathy toward waste, bureaucratic incompetence, and above all toward exploitation and injustice” (Simpson 127). As Anthony Simpson points out, Dickens did not sympathise with the condemned: “He wrote as a realist and not a moralist and his lack of sympathy for the criminal was clear, explicit and stated often” (128). Simpson also notes that Dickens’s letters on execution written in 1846 were “strongly supportive of total abolition” while later letters, written in 1849, presented arguments against public executions rather than the practice of execution. In 1859 Dickens argued against pardoning a poisoner. While in 1864 he supported the execution of the railway carriage murderer Franz Müller, explaining he would be glad to abolish both public executions and capital punishment, “if I knew what to do with the Savages of civilisation. As I do not, I would rid Society of them, when they shed blood, in a very solemn manner” (in Simpson 138-39) that is, executions should proceed but should take place in private.Importantly, Dickens was consistently concerned about society’s fascination with the scaffold. In his second letter to The Daily News, Dickens asks: round what other punishment does the like interest gather? We read of the trials of persons who have rendered themselves liable to transportation for life, and we read of their sentences, and, in some few notorious instances, of their departure from this country, and arrival beyond the sea; but they are never followed into their cells, and tracked from day to day, and night to night; they are never reproduced in their false letters, flippant conversations, theological disquisitions with visitors, lay and clerical […]. They are tried, found guilty, punished; and there an end. (“To the Editors of The Daily News” 6)In this passage, Dickens describes an overt curiosity with those criminals destined for the most awful of punishments. A curiosity that was put on vile display when a mob gathered on the concourse to watch a hanging; a sight which Dickens readily admitted “made [his] blood run cold” (“Letter to the Editor” 4).Dickens’s novels are grand stories, many of which feature criminals and criminal sub-plots. There are, for example, numerous criminals, including the infamous Fagin in Oliver Twist; or, The Parish Boy’s Progress (1838); several rioters are condemned to hang in Barnaby Rudge: A Tale of the Riots of Eighty (1841); there is murder in The Life and Adventures of Martin Chuzzlewit (1844); and murder, too, in Bleak House (1853). Yet, Dickens never wavered in his revulsion for the public display of the execution as revealed in his “refusal to portray the scene at the scaffold [which] was principled and heartfelt. He came, reluctantly to support capital punishment, but he would never use its application for dramatic effect” (Simpson 141).The Police Detective: A Public Relations ExerciseBy the mid-1700s the crime story was one of “sin to crime and then the gallows” (Rawlings online): “Crimes of every defcription (sic) have their origin in the vicious and immoral habits of the people” (Colquhoun 32). As Philip Rawlings notes, “once sin had been embarked upon, capture and punishment followed” (online). The origins of this can be found in the formula relied upon by Samuel Smith in the seventeenth century. Smith was the Ordinary of Newgate, or prison chaplain (1676–1698), who published Accounts of criminals and their gruesome ends. The outputs swelled the ranks of the already burgeoning market of broadsides, handbills and pamphlets. Accounts included: 1) the sermon delivered as the prisoner awaited execution; 2) a brief overview of the crimes for which the prisoner was being punished; and 3) a reporting of the events that surrounded the execution (Gladfelder 52–53), including the prisoner’s behaviour upon the scaffold and any last words spoken. For modern readers, the detective and the investigation is conspicuously absent. These popular Accounts (1676–1772)—over 400 editions offering over 2,500 criminal biographies—were only a few pence a copy. With print runs in the thousands, the Ordinary earnt up to £200 per year for his efforts (Emsley, Hitchcock, and Shoemaker online). For:penitence and profit made comfortable bedfellows, ensuring true crime writing became a firm feature of the business of publishing. That victims and villains suffered was regrettable but no horror was so terrible anyone forgot there was money to be made. (Franks, “Stealing Stories” 7)As the changes brought about by the Industrial Revolution were having their full impact, many were looking for answers, and certainty, in a period of radical social transformation. Sin as a central motif in crime stories was insufficient: the detective was becoming essential (Franks, “True Crime” 239). “In the nineteenth century, the role of the newly-fashioned detective as an agent of consolation or security is both commercially and ideologically central to the subsequent project of popular crime writing” (Bell 8). This was supported by an “increasing professionalism and proficiency of policemen, detectives, and prosecutors, new understandings about psychology, and advances in forensic science and detection techniques” (Murley 10). Elements now included in most crime narratives. Dickens insisted that the detective was a crucial component of the justice system—a figure to be celebrated, one to take centre stage in the crime story—reflecting his staunch support “of the London Metropolitan Police” (Simpson 140). Indeed, while Dickens is known principally for exposing wretched poverty, he was also interested in a range of legal issues as can be evinced from his writings for Household Words. Image 2: Household Words 27 July 1850 (Front Page). Image credit: Dickens Journals Online. W.H. Wills argued for the acceptance of the superiority of the detective when, in 1850, he outlined the “difference between a regular and a detective policeman” (368). The detective must, he wrote: “counteract every sort of rascal whose only means of existence it avowed rascality, but to clear up mysteries, the investigation of which demands the utmost delicacy and tact” (368). The detective is also extraordinarily efficient; cases are solved quickly, in one example a matter is settled in just “ten minutes” (369).Dickens’s pro-police pieces, included a blatantly promotional, two-part work “A Detective Police Party” (1850). The narrative begins with open criticism of the Bow Street Runners contrasting these “men of very indifferent character” to the Detective Force which is “so well chosen and trained, proceeds so systematically and quietly, does its business in such a workman-like manner, and is always so calmly and steadily engaged in the service of the public” (“Police Party, Part I” 409). The “party” is just that: a gathering of detectives and editorial staff. Men in a “magnificent chamber”, seated at “a round table […] with some glasses and cigars arranged upon it; and the editorial sofa elegantly hemmed in between that stately piece of furniture and the wall” (“Police Party, Part I” 409). Two inspectors and five sergeants are present. Each man prepared to share some of their experiences in the service of Londoners:they are, [Dickens tells us] one and all, respectable-looking men; of perfectly good deportment and unusual intelligence; with nothing lounging or slinking in their manners; with an air of keen observation, and quick perception when addressed; and generally presenting in their faces, traces more or less marked of habitually leading lives of strong mental excitement. (“Police Party, Part I” 410) Dickens goes to great lengths to reinforce the superiority of the police detective. These men, “in a glance, immediately takes an inventory of the furniture and an accurate sketch of the editorial presence” and speak “very concisely, and in well-chosen language” and who present as an “amicable brotherhood” (“Police Party, Part I” 410). They are also adaptable and constantly working to refine their craft, through apeculiar ability, always sharpening and being improved by practice, and always adapting itself to every variety of circumstances, and opposing itself to every new device that perverted ingenuity can invent, for which this important social branch of the public service is remarkable! (“Police Party, Part II” 459)These detectives are also, in some ways, familiar. Dickens’s offerings include: a “shrewd, hard-headed Scotchman – in appearance not at all unlike a very acute, thoroughly-trained schoolmaster”; a man “with a ruddy face and a high sun-burnt forehead, [who] has the air of one who has been a Sergeant in the army” (“Police Party, Part I” 409-10); and another man who slips easily into the role of the “greasy, sleepy, shy, good-natured, chuckle-headed, un-suspicious, and confiding young butcher” (“Police Party, Part II” 457). These descriptions are more than just attempts to flesh out a story; words on a page reminding us that the author is not just another journalist but one of the great voices of the Victorian era. These profiles are, it is argued here, a deliberate strategy to reassure readers.In summary, police detectives are only to be feared by those residing on the wrong side of the law. For those without criminal intent; detectives are, in some ways, like us. They are people we already know and trust. The stern but well-meaning, intelligent school teacher; the brave and loyal soldier defending the Empire; and the local merchant, a person we see every day. Dickens provides, too, concrete examples for how everyone can contribute to a safer society by assisting these detectives. This, is perfect public relations. Thus, almost singlehandedly, he builds a professional profile for a new type of police officer. The problem (crime) and its solution (the detective) neatly packaged, with step-by-step instructions for citizens to openly support this new-style of constabulary and so achieve a better, less crime-ridden community. This is a theme pursued in “Three Detective Anecdotes” (1850) where Dickens continued to successfully merge “solid lower-middle-class respectability with an intimate knowledge of the criminal world” (Priestman 177); so, proffering the ideal police detective. A threat to the criminal but not to the hard-working and honest men, women, and children of the city.The Detective: As Fact and as FictionThese writings are also a precursor to one of the greatest fictional detectives of the English-speaking world. Dickens observes that, for these new-style police detectives: “Nothing is so common or deceptive as such appearances at first” (“Police Party, Part I” 410). In 1891, Arthur Conan Doyle would write that: “There is nothing so deceptive as an obvious fact” (78). Dickens had prepared readers for the consulting detective Sherlock Holmes: who was smarter, more observant and who had more determination to take on criminals than the average person. The readers of Dickens were, in many respects, positioned as prototypes of Dr John Watson: a hardworking, loyal Englishman. Smart. But not as smart as those who would seek to do harm. Watson needed Holmes to make the world a better place; the subscriber to Household Words needed the police detective.Another article, “On Duty with Inspector Field” (1851), profiled the “well-known hand” responsible for bringing numerous offenders to justice and sending them, “inexorably, to New South Wales” (Dickens 266). Critically this true crime narrative would be converted into a crime fiction story as Inspector Field is transformed (it is widely believed) into the imagined Inspector Bucket. The 1860s have been identified as “a period of awakening for the detective novel” (Ashley x), a predictor of which is the significant sub-plot of murder in Dickens’s Bleak House. In this novel, a murder is committed with the case taken on, and competently solved by, Bucket who is a man of “skill and integrity” a man presented as an “ideal servant” though one working for a “flawed legal system” (Walton 458). Mr Snagsby, of Bleak House, observes Bucket as a man whoseems in some indefinable manner to lurk and lounge; also, that whenever he is going to turn to the right or left, he pretends to have a fixed purpose in his mind of going straight ahead, and wheels off, sharply at the very last moment [… He] notices things in general, with a face as unchanging as the great mourning ring on his little finger, or the brooch, composed of not much diamond and a good deal of setting, which he wears in his shirt. (278) This passage, it is argued here, places Bucket alongside the men at the detective police party in Household Words. He is simultaneously superhuman in mind and manner, though rather ordinary in dress. Like the real-life detectives of Dickens’s articles; he is a man committed to keeping the city safe while posing no threat to law-abiding citizens. ConclusionThis article has explored, briefly, the contributions of the highly-regarded Victorian author, Charles Dickens, to factual and fictional crime writing. The story of Dickens as a social commentator is one that is familiar to many; what is less well-known is the connection of Dickens to important conversations around capital punishment and the rise of the detective in crime-focused narratives; particularly how he assisted in building the professional profile of the police detective. In this way, through fact and fiction, Dickens performed great (if under-acknowledged) public services around punishment and law enforcement: he contributed to debates on the death penalty and he helped to build trust in the radical social project that established modern-day policing.AcknowledgementsThe author offers her sincere thanks to the New South Wales Dickens Society, Simon Dwyer, and Peter Kirkpatrick. The author is also grateful to the reviewers of this article for their thoughtful comments and valuable suggestions. ReferencesAshley, Mike. “Introduction: Seeking the Evidence.” The Notting Hill Mystery. Author. Charles Warren Adams. London: The British Library, 2012. xxi-iv. Bell, Ian A. “Eighteenth-Century Crime Writing.” The Cambridge Companion to Crime Fiction. Ed. Martin Priestman. Cambridge: Cambridge UP, 2003/2006. 7-17.Brandwood, Katherine. “The Dark and Dreadful Interest”: Charles Dickens, Public Death and the Amusements of the People. MA Thesis. Washington, DC: Georgetown University, 2013. 19 Feb. 2017 <https://repository.library.georgetown.edu/bitstream/handle/10822/558266/Brandwood_georgetown_0076M_12287.pdf;sequence=1>.Collins, Philip. Dickens and Crime. London: Macmillan & Co, 1964.Cruickshanks, Eveline, and Howard Erskine-Hill. “The Waltham Black Act and Jacobitism.” Journal of British Studies 24.3 (1985): 358-65.Dickens, Charles. Oliver Twist; or, The Parish Boy’s Progress. London: Richard Bentley,1838.———. Barnaby Rudge: A Tale of the Riots of Eighty. London: Chapman & Hall, 1841. ———. The Life and Adventures of Martin Chuzzlewit. London: Chapman & Hall, 1844.———. “To the Editors of The Daily News.” The Daily News 28 Feb. 1846: 6. (Reprinted in Antony E. Simpson. Witnesses to the Scaffold. Lambertville: True Bill P, 2008. 141–149.)———. “Letter to the Editor.” The Times 14 Nov. 1849: 4. (Reprinted in Antony E. Simpson. Witnesses to the Scaffold. Lambertville: True Bill P, 2008. 149-51.)———. “A Detective Police Party, Part I.” Household Words 1.18 (1850): 409-14.———. “A Detective Police Party, Part II.” Household Words 1.20 (1850): 457-60.———. “Three Detective Anecdotes.” Household Words 1.25 (1850): 577-80.———. “On Duty with Inspector Field.” Household Words 3.64 (1851): 265-70.———. Bleak House. London: Bradbury and Evans, 1853/n.d.Doyle, Arthur Conan. “The Boscombe Valley Mystery.” The Adventures of Sherlock Holmes. London: Penguin, 1892/1981. 74–99.Emsley, Clive, Tim Hitchcock, and Robert Shoemaker. “The Proceedings: Ordinary of Newgate’s Accounts.” Old Bailey Proceedings Online, n.d. 4 Feb. 2017 <https://www.oldbaileyonline.org/static/Ordinarys-accounts.jsp>. Franks, Rachel. “True Crime: The Regular Reinvention of a Genre.” Journal of Asia-Pacific Pop Culture 1.2 (2016): 239-54. ———. “Stealing Stories: Punishment, Profit and the Ordinary of Newgate.” Refereed Proceedings of the 21st Conference of the Australasian Association of Writing Programs: Authorised Theft. Eds. Niloofar Fanaiyan, Rachel Franks, and Jessica Seymour. 2016. 1-11. 20 Mar. 2017 <http://www.aawp.org.au/publications/the-authorised-theft-papers/>.Gatrell, V.A.C. The Hanging Tree: Execution and the English People, 1770-1868. Oxford: Oxford UP, 1996.Gladfelder, Hal. Criminality and Narrative in Eighteenth-Century England. Baltimore: Johns Hopkins UP, 2001.Hitchens, Peter. A Brief History of Crime: The Decline of Order, Justice and Liberty in England. London: Atlantic Books, 2003.Lyman, J.L. “The Metropolitan Police Act of 1829.” Journal of Criminal Law, Criminology and Police Science 55.1 (1964): 141-54.Murley, Jean. The Rise of True Crime: 20th Century Murder and American Popular Culture. Westport: Praeger, 2008.Pepper, Andrew. “Early Crime Writing and the State: Jonathan Wilde, Daniel Defoe and Bernard Mandeville in 1720s London.” Textual Practice 25.3 (2011): 473-91. Priestman, Martin. “Post-War British Crime Fiction.” The Cambridge Companion to Crime Fiction. Ed. Martin Priestman. Cambridge: Cambridge UP, 2003. 173-89.Rawlings, Philip. “True Crime.” The British Criminology Conferences: Selected Proceedings, Volume 1: Emerging Themes in Criminology. Eds. Jon Vagg and Tim Newburn. London: British Society of Criminology (1998). 4 Feb. 2017 <http://www.britsoccrim.org/volume1/010.pdf>.Simpson, Antony E. Witnesses to the Scaffold: English Literary Figures as Observers of Public Executions. Lambertville: True Bill P, 2008.Walton, James. “Conrad, Dickens, and the Detective Novel.” Nineteenth-Century Fiction 23.4 (1969): 446-62.Wills, William Henry. “The Modern Science of Thief-Taking.” Household Words 1.16 (1850): 368-72.Worsley, Lucy. A Very British Murder: The Curious Story of How Crime Was Turned into Art. London: BBC Books, 2013/2014.

Moldy core is a fungal disease of apple fruits that is characterized by mycelial growth in the seed locules and is sometimes accompanied by penetration of the immediate surrounding flesh. The disease can go undetected until the fruit is cut open, as no external symptoms appear on the fruit. Alternaria, Aspergillus, Cladosporium, Coniothyrium, Epicoccum, Phoma and Stemphylium are some of the common pathogens associated with moldy core (Serdani et al. 2002; Gao et al. 2013; McLeod 2014). The disease is more common in apple cultivars with an open calyx, where spores may initiate infections during the growing season or at the post-harvest storage stage (Spotts et al. 1988). In 2018, a shipment of ‘Sweet Tango’ apples from New Zealand to Scotian Gold Co-operative Ltd., Nova Scotia, Canada, was found to be affected by moldy core. Moderate to severe moldy core symptoms were observed when 10 apples were cut open (Figure S1). In comparison, ‘Sweet Tango’ apples grown in Nova Scotia showed no moldy core symptoms when 10 random fruits were cut open. Small pieces of the diseased fruit tissue from the core region were surface-disinfected for 1 min in 1% NaOCl, rinsed three times with sterilized water and placed onto potato dextrose agar (PDA) dishes. The PDA dishes were incubated in dark at 22 oC and single spore isolation was carried out to fresh PDA dishes. These isolate produced colonies of regular shape, tan black with prominent white gray margin and gray colour conidia (Figure S2 AB). The colonies turn dark black after 3 weeks of growth on PDA. Mycelia were septate and conidia were oval or obclavate or club-shaped with a tapering end with 4-6 longitudinal and transverse septa (Figure S2 C-D). The size of conidia ranges from 12.5-20 x 8.7-12.5 µM on 20 days old PDA dishes. Based on the size and shape of conidia and other morphological characteristics the isolated fungi were identical to Alternaria spp. (Simmons 2007). To assess the identity of the isolated pathogen species by multi-locus sequence analysis, genomic DNA was extracted from the pure cultures of two isolates (5.8 and 8) using the E.Z.N.A. SP Fungal DNA Kit (Omega Bio-Tek). The glyceraldehyde-3-phosphate dehydrogenase (GAPDH), major allergen (Alt a 1), OPA10-2, the internal transcribed spacer (ITS) region of ribosomal DNA and the translation elongation factor 1-α (TEF1-α) region from two Alternaria spp. isolates (5.8 and 8) were amplified and sequenced using primers gpd1/2 (Berbee et al. 1999), A21F/A21R (Gabriel 2015), OPA10-2/ OPA10-2L (Andrew et al. 2009), ITS1/ITS4 (White et al. 1990) and EF1-up /EF1-low (O’Donnell et al. 1998) respectively. The resulting sequences of both isolates were deposited in the NCBI GenBank (GAPDH; MW411052, MW411053, Alt a 1; MW411050, MW411051, OPA10-2; MW415762, MW415763, ITS; MK140445, MT225559, TEF1-α; MT305773 and MT305774 ). Sequences of GAPDH, Alt a 1, OPA-10-2, ITS and TEF1-α genes of both isolates were identical to each other and showed 100 %, 100 %, 99.21 %, 100% and 100% identity to A. arborescens S. (AY278810.1, AY563303.1, KP124712.1, KY965831.1, KY965831.1) respectively. Identity with reference strain CBS 102605 confirms that both of the isolated strains 5.8 and 8 are A. arborescens. The pathogenicity of the two A. arborescens isolates were confirmed by artificially inoculating healthy ‘Sweet Tango’ fruit by dispensing the conidial suspension directly on the seed locule. Briefly, surface-disinfected fruits were air-dried for 5 min and then peeled using a sterilized knife and cut transversally. Each half of the fruit was inoculated with 100 µl of conidial suspensions (∼1 × 104 conidia/ml) in potato dextrose broth (PDB) and incubated at 22 °C in a humid chamber for 7–10 days, or until symptoms with visible mycelial growth were observed. The control fruits were treated with 100 µl of sterilized PDB. Both A. arborescens isolates produced visible moldy core symptoms on the inoculated ‘Sweet Tango’ fruits, whereas no symptoms were observed on the control fruits (Figure S1). The experiment was repeated three times with at least three replicates with similar results. A. arborescens was successfully re-isolated from the artificially-inoculated fruits to complete Koch’s postulates. To our knowledge, this is the first report of Alternaria arborescens causing moldy core disease in ‘Sweet Tango’ apples from New Zealand. Acknowledgments We thank Eric Bevis for his help in sample preparation for DNA sequencing, Willy Renderos for pathogenicity assay. We also thank Joan Hebb (Scotian Gold Cooperative Ltd.,) for providing the apple sample for this study. This research was made possible through financial support from Agriculture and Agri-Food Canada. The authors(s) declare no conflict of interest. Literature Cited Andrew M., Peever T.L., Pryor B.M. An expanded multilocus phylogeny does not resolve species among the small-spored Alternaria species complex. 2009. Mycologia. 101:95–109. Berbee, M. L. et al. 1999. Cochliobolus phylogenetics and the origin of known, highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences Mycologia. 91:964. Gabriel, M.F. I. Postigo, A. Gutiérrez-Rodríguez, E. Suñén, C.T. Tomaz, J. Martínez 2015. Development of a PCR-based tool for detecting immunologically relevant Alt a 1 and Alt a 1 homologue coding sequences. Medical Mycology. 53 (6):636–642. Gao, L. L., Zhang, Q., Sun, X. Y., Jiang, L., Zhang, R., Sun, G. Y., Zha, Y. L., and Biggs, A. R. 2013. Etiology of moldy core, core browning, and core rot of Fuji apple in China. Plant Dis. 97:510–516. Kerry, O’Donnell, H.C. Kistler, E. Cigelnik, R.C. Ploetz. 1998. Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. PNAS. 95: 2044-2049. McLeod, A. 2014. Moldy core and core rots. Pages 40–41 in: Compendium of Apple and Pear Diseases and Pests, 2nd ed. T. B. Sutton, H. S. Aldwinckle, A. M. Agnello, and J. F. Walgenbach, eds. American Phytopathological Society, St Paul, MN. Serdani, M., Kang, J. C., Peever, T. L., Andersen, B., and Crous, P. W. 2002. Characterization of Alternaria species groups associated with core rot of apples in South Africa. Mycol. Res. 106:561–569. Simmons, E. G. 2007. Alternaria: an identification manual. CBS Biodiversity Series. 6:780 pp. Spotts, R. A., Holmes, R. J., and Washington, W. S. 1988. Factors affecting wet core rot of apples. Australas. Plant Pathol. 17:53–57. White, T. J., Bruns, T., Lee, S., and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pages 315–322 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White, eds. San Diego, CA: Academic Press. Woudenberg, J. H. C., et al. 2015. Alternaria section Alternaria: Species, formae speciales or pathotypes. Stud. Mycol. 82:1-21.

Image 1: A Little Free Library. Image credit: Nadine Kozak.IntroductionLittle Free Libraries give people a reason to stop and exchange things they love: books. It seemed like a really good way to build a sense of community.Dannette Lank, Little Free Library steward, Whitefish Bay, Wisconsin, 2013 (Rumage)Against a backdrop of stagnant literacy rates and enduring perceptions of urban decay and the decline of communities in cities (NCES, “Average Literacy”; NCES, “Average Prose”; Putnam 25; Skogan 8), legions of Little Free Libraries (LFLs) have sprung up across the United States between 2009 and the present. LFLs are small, often homemade structures housing books and other physical media for passersby to choose a book to take or leave a book to share with others. People have installed the structures in front of homes, schools, libraries, churches, fire and police stations, community gardens, and in public parks. There are currently 50,000 LFLs around the world, most of which are in the continental United States (Aldrich, “Big”). LFLs encompass building in multiple senses of the term; LFLs are literally tiny buildings to house books and people use the structures for building neighbourhood social capital. The organisation behind the movement cites “building community” as one of its three core missions (Little Free Library). Rowan Moore, theorising humans’ reasons for building, argues desire and emotion are central (16). The LFL movement provides evidence for this claim: stewards erect LFLs based on hope for increased literacy and a desire to build community through their altruistic actions. This article investigates how LFLs build urban community and explores barriers to the endeavour, specifically municipal building and right of way ordinances used in attempts to eradicate the structures. It also examines local responses to these municipal actions and potential challenges to traditional public libraries brought about by LFLs, primarily the decrease of visits to public libraries and the use of LFLs to argue for defunding of publicly provided library services. The work argues that LFLs build community in some places but may threaten other community services. This article employs qualitative content analysis of 261 stewards’ comments about their registered LFLs on the organisation’s website drawn from the two largest cities in a Midwestern state and an interview with an LFL steward in a village in the same state to analyse how LFLs build community. The two cities, located in the state where the LFL movement began, provide a cross section of innovators, early adopters, and late adopters of the book exchanges, determined by their registered charter numbers. Press coverage and municipal documents from six cities across the US gathered through a snowball sample provide data about municipal challenges to LFLs. Blog posts penned by practising librarians furnish some opinions about the movement. This research, while not a representative sample, identifies common themes and issues around LFLs and provides a basis for future research.The act of building and curating an LFL is a representation of shared beliefs about literacy, community, and altruism. Establishing an LFL is an act of civic participation. As Nico Carpentier notes, while some civic participation is macro, carried out at the level of the nation, other participation is micro, conducted in “the spheres of school, family, workplace, church, and community” (17). Ruth H. Landman investigates voluntary activities in the city, including community gardening, and community bakeries, and argues that the people associated with these projects find themselves in a “denser web of relations” than previously (2). Gretchen M. Herrmann argues that neighbourhood garage sales, although fleeting events, build an enduring sense of community amongst participants (189). Ray Oldenburg contends that people create associational webs in what he calls “great good places”; third spaces separate from home and work (20-21). Little Free Libraries and Community BuildingEmotion plays a central role in the decision to become an LFL steward, the person who establishes and maintains the LFL. People recount their desire to build a sense of community and share their love of reading with neighbours (Charter 4684; Charter 8212; Charter 9437; Charter 9705; Charter 16561). One steward in the study reported, “I love books and I want to be able to help foster that love in our neighbourhood as well” (Charter 4369). Image 2: A Little Free Library, bench, water fountain, and dog’s water bowl for passersby to enjoy. Image credit: Nadine Kozak.Relationships and emotional ties are central to some people’s decisions to have an LFL. The LFL website catalogues many instances of memorial LFLs, tributes to librarians, teachers, and avid readers. Indeed, the first Little Free Library, built by Todd Bol in 2009, was a tribute to his late mother, a teacher who loved reading (“Our History”). In the two city study area, ten LFLs are memorials, allowing bereaved families to pass on a loved one’s penchant for sharing books and reading (Charter 1235; Charter 1309; Charter 4604; Charter 6219; Charter 6542; Charter 6954; Charter 10326; Charter 16734; Charter 24481; Charter 30369). In some cases, urban neighbours come together to build, erect, and stock LFLs. One steward wrote: “Those of us who live in this friendly neighborhood collaborated to design[,] build and paint a bungalow themed library” to match the houses in the neighbourhood (Charter 2532). Another noted: “Our neighbor across the street is a skilled woodworker, and offered to build the library for us if we would install it in our yard and maintain it. What a deal!” (Charter 18677). Community organisations also install and maintain LFLs, including 21 in the study population (e.g. Charter 31822; Charter 27155).Stewards report increased communication with neighbours due to their LFLs. A steward noted: “We celebrated the library’s launch on a Saturday morning with neighbors of all ages. We love sitting on our front porch and catching up with the people who stop to check out the books” (Charter 9673). Another exclaimed:within 24 hours, before I had time to paint it, my Little Free Library took on a life of its own. All of a sudden there were lots of books in it and people stopping by. I wondered where these books came from as I had not put any in there. Little kids in the neighborhood are all excited about it and I have met neighbors that I had never seen before. This is going to be fun! (Charter 15981)LFLs build community through social interaction and collaboration. This occurs when neighbours come together to build, install, and fill the structures. The structures also open avenues for conversation between neighbours who had no connection previously. Like Herrmann’s neighbourhood garage sales, LFLs create and maintain social ties between neighbours and link them by the books they share. Additionally, when neighbours gather and communicate at the LFL structure, they create a transitory third space for “informal public life”, where people can casually interact at a nearby location (Oldenburg 14, 288).Building Barriers, Creating CommunityThe erection of an LFL in an urban neighbourhood is not, however, always a welcome sight. The news analysis found that LFLs most often come to the attention of municipal authorities via citizen complaints, which lead to investigations and enforcement of ordinances. In Kansas, a neighbour called an LFL an “eyesore” and an “illegal detached structure” (Tapper). In Wisconsin, well-meaning future stewards contacted their village authorities to ask about rules, inadvertently setting off a six-month ban on LFLs (Stingl; Rumage). Resulting from complaints and inquiries, municipalities regulated, and in one case banned, LFLs, thus building barriers to citizens’ desires to foster community and share books with neighbours.Municipal governments use two major areas of established code to remove or prohibit LFLs: ordinances banning unapproved structures in residents’ yards and those concerned with obstructions to right of ways when stewards locate the LFLs between the public sidewalk and street.In the first instance, municipal ordinances prohibit either front yard or detached structures. Controversies over these ordinances and LFLs erupted in Whitefish Bay, Wisconsin, in 2012; Leawood, Kansas, in 2014; Shreveport, Louisiana, in 2015; and Dallas, Texas, in 2015. The Village of Whitefish Bay banned LFLs due to an ordinance prohibiting “front yard structures,” including mailboxes (Sanburn; Stingl). In Leawood, the city council argued that an LFL, owned by a nine-year-old boy, violated an ordinance that forbade the construction of any detached structures without city council permission. In Shreveport, the stewards of an LFL received a cease and desist letter from city council for having an “accessory structure” in the front yard (LaCasse; Burris) and Dallas officials knocked on a steward’s front door, informing her of a similar breach (Kellogg).In the second instance, some urban municipalities argued that LFLs are obstructions that block right of ways. In Lincoln, Nebraska, the public works director noted that the city “uses the area between the sidewalk and the street for snow storage in the winter, light poles, mailboxes, things like that.” The director continued: “And I imagine these little libraries are meant to congregate people like a water cooler, but we don’t want people hanging around near the road by the curb” (Heady). Both Lincoln in 2014 and Los Angeles (LA), California, in 2015, cited LFLs for obstructions. In Lincoln, the city notified the Southminster United Methodist Church that their LFL, located between the public sidewalk and street, violated a municipal ordinance (Sanburn). In LA, the Bureau of Street Services notified actor Peter Cook that his LFL, situated in the right of way, was an “obstruction” that Cook had to remove or the city would levy a fine (Moss). The city agreed at a hearing to consider a “revocable permit” for Cook’s LFL, but later denied its issuance (Condes).Stewards who found themselves in violation of municipal ordinances were able to harness emotion and build outrage over limits to individuals’ ability to erect LFLs. In Kansas, the stewards created a Facebook page, Spencer’s Little Free Library, which received over 31,000 likes and messages of support. One comment left on the page reads: “The public outcry will force those lame city officials to change their minds about it. Leave it to the stupid government to rain on everybody’s parade” (“Good”). Children’s author Daniel Handler sent a letter to the nine-year-old steward, writing as Lemony Snicket, “fighting against librarians is immoral and useless in the face of brave and noble readers such as yourself” (Spencer’s). Indeed, the young steward gave a successful speech to city hall arguing that the body should allow the structures because “‘lots of people in the neighborhood used the library and the books were always changing. I think it’s good for Leawood’” (Bauman). Other local LFL supporters also attended council and spoke in favour of the structures (Harper). In LA, Cook’s neighbours started a petition that gathered over 100 signatures, where people left comments including, “No to bullies!” (Lopez). Additionally, neighbours gathered to discuss the issue (Dana). In Shreveport, neighbours left stacks of books in their front yards, without a structure housing them due to the code banning accessory structures. One noted, “I’m basically telling the [Metropolitan Planning Commission] to go sod off” (Friedersdorf; Moss). LFL proponents reacted with frustration and anger at the perceived over-reach of the government toward harmless LFLs. In addition to the actions of neighbours and supporters, the national and local press commented on the municipal constraints. The LFL movement has benefitted from a significant amount of positive press in its formative years, a press willing to publicise and criticise municipal actions to thwart LFL development. Stewards’ struggles against municipal bureaucracies building barriers to LFLs makes prime fodder for the news media. Herbert J. Gans argues an enduring value in American news is “the preservation of the freedom of the individual against the encroachments of nation and society” (50). The juxtaposition of well-meaning LFL stewards against municipal councils and committees provided a compelling opportunity to illustrate this value.National media outlets, including Time (Sanburn), Christian Science Monitor (LaCasse), and The Atlantic, drew attention to the issue. Writing in The Atlantic, Conor Friedersdorf critically noted:I wish I was writing this to merely extol this trend [of community building via LFLs]. Alas, a subset of Americans are determined to regulate every last aspect of community life. Due to selection bias, they are overrepresented among local politicians and bureaucrats. And so they have power, despite their small-mindedness, inflexibility, and lack of common sense so extreme that they’ve taken to cracking down on Little Free Libraries, of all things. (Friedersdorf, n.p.)Other columnists mirrored this sentiment. Writing in the LA Times, one commentator sarcastically wrote that city officials were “cracking down on one of the country’s biggest problems: small community libraries where residents share books” (Schaub). Journalists argued this was government overreach on non-issues rather than tackling larger community problems, such as income inequality, homelessness, and aging infrastructure (Solomon; Schaub). The protests and negative press coverage led to, in the case of the municipalities with front yard and detached structure ordinances, détente between stewards and councils as the latter passed amendments permitting and regulating LFLs. Whitefish Bay, Leawood, and Shreveport amended ordinances to allow for LFLs, but also to regulate them (Everson; Topil; Siegel). Ordinances about LFLs restricted their number on city blocks, placement on private property, size and height, as well as required registration with the municipality in some cases. Lincoln officials allowed the church to relocate the LFL from the right of way to church property and waived the $500 fine for the obstruction violation (Sanburn). In addition to the amendments, the protests also led to civic participation and community building including presentations to city council, a petition, and symbolic acts of defiance. Through this protest, neighbours create communities—networks of people working toward a common goal. This aspect of community building around LFLs was unintentional but it brought people together nevertheless.Building a Challenge to Traditional Libraries?LFL marketing and communication staff member Margaret Aldrich suggests in The Little Free Library Book that LFLs are successful because they are “gratifyingly doable” projects that can be accomplished by an individual (16). It is this ease of building, erecting, and maintaining LFLs that builds concern as their proliferation could challenge aspects of library service, such as public funding and patron visits. Some professional librarians are in favour of the LFLs and are stewards themselves (Charter 121; Charter 2608; Charter 9702; Charter 41074; Rumage). Others envision great opportunities for collaboration between traditional libraries and LFLs, including the library publicising LFLs and encouraging their construction as well as using LFLs to serve areas without, or far from, a public library (Svehla; Shumaker). While lauding efforts to build community, some professional librarians question the nomenclature used by the movement. They argue the phrase Little Free Libraries is inaccurate as libraries are much more than random collections of books. Instead, critics contend, the LFL structures are closer to book swaps and exchanges than actual libraries, which offer a range of services such as Internet access, digital materials, community meeting spaces, and workshops and programming on a variety of topics (American Library Association; Annoyed Librarian). One university reference and instruction librarian worries about “the general public’s perception and lumping together of little free libraries and actual ‘real’ public libraries” (Hardenbrook). By way of illustration, he imagines someone asking, “‘why do we need our tax money to go to something that can be done for FREE?’” (Hardenbrook). Librarians holding this perspective fear the movement might add to a trend of neoliberalism, limiting or ending public funding for libraries, as politicians believe that the localised, individual solutions can replace publicly funded library services. This is a trend toward what James Ferguson calls “responsibilized” citizens, those “deployed to produce governmentalized results that do not depend on direct state intervention” (172). In other countries, this shift has already begun. In the United Kingdom (UK), governments are devolving formerly public services onto community groups and volunteers. Lindsay Findlay-King, Geoff Nichols, Deborah Forbes, and Gordon Macfadyen trace the impacts of the 2012 Localism Act in the UK, which caused “sport and library asset transfers” (12) to community and volunteer groups who were then responsible for service provision and, potentially, facility maintenance as well. Rather than being in charge of a “doable” LFL, community groups and volunteers become the operators of much larger facilities. Recent efforts in the US to privatise library services as governments attempt to cut budgets and streamline services (Streitfeld) ground this fear. Image 3: “Take a Book, Share a Book,” a Little Free Library motto. Image credit: Nadine Kozak. LFLs might have real consequences for public libraries. Another potential unintended consequence of the LFLs is decreasing visits to public libraries, which could provide officials seeking to defund them with evidence that they are no longer relevant or necessary. One LFL steward and avid reader remarked that she had not used her local public library since 2014 because “I was using the Little Free Libraries” (Steward). Academics and librarians must conduct more research to determine what impact, if any, LFLs are having on visits to traditional public libraries. ConclusionLittle Free Libraries across the United States, and increasingly in other countries, have generated discussion, promoted collaboration between neighbours, and led to sharing. In other words, they have built communities. This was the intended consequence of the LFL movement. There, however, has also been unplanned community building in response to municipal threats to the structures due to right of way, safety, and planning ordinances. The more threatening concern is not the municipal ordinances used to block LFL development, but rather the trend of privatisation of publicly provided services. While people are celebrating the community built by the LFLs, caution must be exercised lest central institutions of the public and community, traditional public libraries, be lost. Academics and communities ought to consider not just impact on their local community at the street level, but also wider structural concerns so that communities can foster many “great good places”—the Little Free Libraries and traditional public libraries as well.ReferencesAldrich, Margaret. “Big Milestone for Little Free Library: 50,000 Libraries Worldwide.” Little Free Library. Little Free Library Organization. 4 Nov. 2016. 25 Feb. 2017 <https://littlefreelibrary.org/big-milestone-for-little-free-library-50000-libraries-worldwide/>.Aldrich, Margaret. The Little Free Library Book: Take a Book, Return a Book. Minneapolis, MN: Coffee House Press, 2015.Annoyed Librarian. “How to Protect Little Free Libraries.” Library Journal Blog 9 Jul. 2015. 26 Mar. 2017 <http://lj.libraryjournal.com/blogs/annoyedlibrarian/2015/07/09/how-to-protect-little-free-libraries/>.American Library Association. “Public Library Use.” State of America’s Libraries: A Report from the American Library Association (2015). 25 Feb. 2017 <http://www.ala.org/tools/libfactsheets/alalibraryfactsheet06>.Bauman, Caroline. “‘Little Free Libraries’ Legal in Leawood Thanks to 9-year-old Spencer Collins.” The Kansas City Star 7 Jul. 2014. 25 Feb. 2017 <http://www.kansascity.com/news/politics-government/article687562.html>.Burris, Alexandria. “First Amendment Issues Surface in Little Free Library Case.” Shreveport Times 5 Feb. 2015. 25 Feb. 2017 <http://www.shreveporttimes.com/story/news/local/2015/02/05/expert-use-zoning-law-clashes-first-amendment/22922371/>.Carpentier, Nico. Media and Participation: A Site of Ideological-Democratic Struggle. Bristol: Intellect, 2011.Charter 121. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 1235. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 1309. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 2532. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 2608. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 4369. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 4604. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 4684. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 6219. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 6542. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 6954. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 8212. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 9437. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 9673. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 9702. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 9705. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 10326. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 15981. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 16561. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 16734. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 18677. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 24481. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 27155. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 30369. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 31822. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Charter 41074. “The World Map.” Little Free Library (2017). 26 Mar. 2017 <https://littlefreelibrary.org/ourmap/>.Condes, Yvonne. “Save the Little Library!” MomsLA 10 Aug. 2015. 25 Feb. 2017 <http://momsla.com/save-the-micro-library/>.Dana. “The Tenn-Mann Library Controversy, Part 3.” Read with Dana (30 Jan. 2015). 25 Feb. 2017 <https://readwithdana.wordpress.com/2015/01/30/the-tenn-mann-library-controversy-part-three/>.Everson, Jeff. “An Ordinance to Amend and Reenact Chapter 106 of the Shreveport Code of Ordinances Relative to Outdoor Book Exchange Boxes, and Otherwise Providing with Respect Thereto.” City of Shreveport, Louisiana 9 Oct. 2015. 25 Feb. 2017 <http://ftpcontent4.worldnow.com/ksla/pdf/LFLordinance.pdf>.Ferguson, James. “The Uses of Neoliberalism.” Antipode 41.S1 (2009): 166-84.Findlay-King, Lindsay, Geoff Nichols, Deborah Forbes, and Gordon Macfadyen. “Localism and the Big Society: The Asset Transfer of Leisure Centres and Libraries—Fighting Closures or Empowering Communities.” Leisure Studies (2017): 1-13.Friedersdorf, Conor. “The Danger of Being Neighborly without a Permit.” The Atlantic 20 Feb. 2015. 25 Feb. 2017 <https://www.theatlantic.com/national/archive/2015/02/little-free-library-crackdown/385531/>.Gans, Herbert J. Deciding What’s News: A Study of CBS Evening News, NBC Nightly News, Newsweek, and Time. Evanston, IL: Northwestern University Press, 2004.“Good Luck Spencer.” Spencer’s Little Free Library Facebook Page 25 Jun. 2014. 26 Mar. 2017 <https://www.facebook.com/Spencerslittlefreelibrary/photos/pcb.527531327376433/527531260709773/?type=3>.Hardenbrook, Joe. “A Little Rant on Little Free Libraries (AKA Probably an Unpopular Post).” Mr. Library Dude (9 Apr. 2014). 25 Feb. 2017 <https://mrlibrarydude.wordpress.com/2014/04/09/a-little-rant-on-little-free-libraries-aka-probably-an-unpopular-post/>.Harper, Deb. “Minutes.” The Leawood City Council 7 Jul. 2014. <http://www.leawood.org/pdf/cc/min/07-07-14.pdf>. Heady, Chris. “City Wants Church to Move Little Library.” Lincoln Journal Star 9 Jul. 2014. 25 Feb. 2017 <http://journalstar.com/news/local/city-wants-church-to-move-little-library/article_7753901a-42cd-5b52-9674-fc54a4d51f47.html>. Herrmann, Gretchen M. “Garage Sales Make Good Neighbors: Building Community through Neighborhood Sales.” Human Organization 62.2 (2006): 181-191.Kellogg, Carolyn. “Officials Threaten to Destroy a Little Free Library in Texas.” Los Angeles Times (1 Oct. 2015). 25 Feb. 2017 <http://www.latimes.com/books/jacketcopy/la-et-jc-little-free-library-texas-20150930-story.html>.LaCasse, Alexander. “Why Are Some Cities Cracking Down on Little Free Libraries.” Christian Science Monitor (5 Feb. 2015). 25 Feb. 2017 <http://www.csmonitor.com/Books/chapter-and-verse/2015/0205/Why-are-some-cities-cracking-down-on-little-free-libraries>.Landman, Ruth H. Creating the Community in the City: Cooperatives and Community Gardens in Washington, DC Westport, CT: Bergin & Garvey, 1993. Little Free Library. Little Free Library Organization (2017). 25 Feb. 2017 <https://littlefreelibrary.org/>.Lopez, Steve. “Actor’s Curbside Libraries Is a Smash—for Most People.” LA Times 3 Feb. 2015. 25 Feb. 2017 <http://www.latimes.com/local/california/la-me-0204-lopez-library-20150204-column.html>.Moore, Rowan. Why We Build: Power and Desire in Architecture. New York: Harper Design, 2013.Moss, Laura. “City Zoning Laws Target Little Free Libraries.” Mother Nature Network 25 Aug. 2015. 25 Feb. 2017 <http://www.mnn.com/lifestyle/arts-culture/stories/city-zoning-laws-target-little-free-libraries>.National Center for Education Statistics (NCES). Average Literacy and Numeracy Scale Scores of 25- to 65-Year Olds, by Sex, Age Group, Highest Level of Educational Attainment, and Country of Other Education System: 2012, table 604.10. 25 Feb. 2017 <https://nces.ed.gov/programs/digest/d15/tables/dt15_604.10.asp?current=yes>.National Center for Education Statistics (NCES). Average Prose, Document, and Quantitative Literacy Scores of Adults: 1992 and 2003. National Assessment of Adult Literacy. 25 Feb. 2017 <https://nces.ed.gov/naal/kf_demographics.asp>.Oldenburg, Ray. The Great Good Place: Cafés, Coffee Shops, Bookstores, Bars, Hair Salons, and Other Hangouts at the Heart of a Community. New York: Marlowe & Company, 1999.“Our History.” Little Free Library. Little Free Library Organization (2017). 25 Feb. 2017 <https://littlefreelibrary.org/ourhistory/>.Putnam, Robert D. Bowling Alone: The Collapse and Revival of American Community. New York: Simon & Schuster, 2001.Rumage, Jeff. “Little Free Libraries Now Allowed in Whitefish Bay.” Whitefish Bay Patch (8 May 2013). 25 Feb. 2017 <http://patch.com/wisconsin/whitefishbay/little-free-libraries-now-allowed-in-whitefish-bay>.Sanburn, Josh. “What Do Kansas and Nebraska Have against Small Libraries?” Time 10 Jul. 2014. 25 Feb. 2017 <http://time.com/2970649/tiny-libraries-violating-city-ordinances/>.Schaub, Michael. “Little Free Libraries on the Wrong Side of the Law.” LA Times 4 Feb. 2015. 25 Feb. 2017 <http://www.latimes.com/books/jacketcopy/la-et-jc-little-free-libraries-on-the-wrong-side-of-the-law-20150204-story.html>.Shumaker, David. “Public Libraries, Little Free Libraries, and Embedded Librarians.” The Embedded Librarian (28 April 2014) 26 Mar. 2017 <https://embeddedlibrarian.com/2014/04/28/public-libraries-little-free-libraries-and-embedded-librarians/>.Siegel, Julie. “An Ordinance to Amend Section 16.13 of the Municipal Code with Regard to Exempt Certain Little Free Libraries from Front Yard Setback Requirements.” Village of Whitefish Bay, Wisconsin (5 Aug. 2013).Skogan, Wesley G. Police and Community in Chicago: A Tale of Three Cities. New York: Oxford University Press, 2006.Solomon, Dan. “Dallas Is Regulating ‘Little Free Libraries’ for Some Reason.” Texas Monthly (14 Sept. 2016). 25 Feb. 2017 <http://www.texasmonthly.com/the-daily-post/dallas-regulating-little-free-libraries-reason/>.“Spencer’s Little Free Library.” Facebook 15 Jul. 2014. 25 Feb. 2017 <https://www.facebook.com/Spencerslittlefreelibrary/photos/pcb.527531327376433/527531260709773/?type=3>.Steward, M. Personal Interview. 7 Feb. 2017.Stingl, Jim. “Village Slaps Endnote on Little Libraries.” Milwaukee Journal Sentinel 11 Nov. 2012: 1B, 7B.Streitfeld, David. “Anger as a Private Company Takes over Libraries.” The New York Times (26 Sept. 2010). 25 Feb. 2017 <http://www.nytimes.com/2010/09/27/business/27libraries.html>.Svehla, Louise. “Little Free Libraries—The Possibilities Are Endless.” Public Libraries Online (8 Mar. 2013). 25 Feb. 2017 <http://publiclibrariesonline.org/2013/03/little-free-libraries-the-possibilities-are-endless/>.Tapper, Jake. “Boy Fights Council to Save His Library.” CNN 4 Jul. 2014. 25 Feb. 2017 <http://thelead.blogs.cnn.com/2014/07/04/boy-fights-to-save-his-library/>.Topil, Greg. “Little Free Libraries in Lincoln.” City of Lincoln, Nebraska (n.d.). 25 Feb. 2017 <http://lincoln.ne.gov/City/pworks/engine/row/little-library.htm>.

Introduction Cookbooks are an exceptional written record of what is largely an oral tradition. They have been described as “magician’s hats” due to their ability to reveal much more than they seem to contain (Wheaton, “Finding”). The first book printed in Germany was the Guttenberg Bible in 1456 but, by 1490, printing was introduced into almost every European country (Tierney). The spread of literacy between 1500 and 1800, and the rise in silent reading, helped to create a new private sphere into which the individual could retreat, seeking refuge from the community (Chartier). This new technology had its effects in the world of cookery as in so many spheres of culture (Mennell, All Manners). Trubek notes that cookbooks are the texts most often used by culinary historians, since they usually contain all the requisite materials for analysing a cuisine: ingredients, method, technique, and presentation. Printed cookbooks, beginning in the early modern period, provide culinary historians with sources of evidence of the culinary past. Historians have argued that social differences can be expressed by the way and type of food we consume. Cookbooks are now widely accepted as valid socio-cultural and historic documents (Folch, Sherman), and indeed the link between literacy levels and the protestant tradition has been expressed through the study of Danish cookbooks (Gold). From Apicius, Taillevent, La Varenne, and Menon to Bradley, Smith, Raffald, Acton, and Beeton, how can both manuscript and printed cookbooks be analysed as historic documents? What is the difference between a manuscript and a printed cookbook? Barbara Ketchum Wheaton, who has been studying cookbooks for over half a century and is honorary curator of the culinary collection in Harvard’s Schlesinger Library, has developed a methodology to read historic cookbooks using a structured approach. For a number of years she has been giving seminars to scholars from multidisciplinary fields on how to read historic cookbooks. This paper draws on the author’s experiences attending Wheaton’s seminar in Harvard, and on supervising the use of this methodology at both Masters and Doctoral level (Cashman; Mac Con Iomaire, and Cashman). Manuscripts versus Printed Cookbooks A fundamental difference exists between manuscript and printed cookbooks in their relationship with the public and private domain. Manuscript cookbooks are by their very essence intimate, relatively unedited and written with an eye to private circulation. Culinary manuscripts follow the diurnal and annual tasks of the household. They contain recipes for cures and restoratives, recipes for cleansing products for the house and the body, as well as the expected recipes for cooking and preserving all manners of food. Whether manuscript or printed cookbook, the recipes contained within often act as a reminder of how laborious the production of food could be in the pre-industrialised world (White). Printed cookbooks draw oxygen from the very fact of being public. They assume a “literate population with sufficient discretionary income to invest in texts that commodify knowledge” (Folch). This process of commoditisation brings knowledge from the private to the public sphere. There exists a subset of cookbooks that straddle this divide, for example, Mrs. Rundell’s A New System of Domestic Cookery (1806), which brought to the public domain her distillation of a lifetime of domestic experience. Originally intended for her daughters alone, Rundell’s book was reprinted regularly during the nineteenth century with the last edition printed in 1893, when Mrs. Beeton had been enormously popular for over thirty years (Mac Con Iomaire, and Cashman). Barbara Ketchum Wheaton’s Structured Approach Cookbooks can be rewarding, surprising and illuminating when read carefully with due effort in understanding them as cultural artefacts. However, Wheaton notes that: “One may read a single old cookbook and find it immensely entertaining. One may read two and begin to find intriguing similarities and differences. When the third cookbook is read, one’s mind begins to blur, and one begins to sense the need for some sort of method in approaching these documents” (“Finding”). Following decades of studying cookbooks from both sides of the Atlantic and writing a seminal text on the French at table from 1300-1789 (Wheaton, Savouring the Past), this combined experience negotiating cookbooks as historical documents was codified, and a structured approach gradually articulated and shared within a week long seminar format. In studying any cookbook, regardless of era or country of origin, the text is broken down into five different groupings, to wit: ingredients; equipment or facilities; the meal; the book as a whole; and, finally, the worldview. A particular strength of Wheaton’s seminars is the multidisciplinary nature of the approaches of students who attend, which throws the study of cookbooks open to wide ranging techniques. Students with a purely scientific training unearth interesting patterns by developing databases of the frequency of ingredients or techniques, and cross referencing them with other books from similar or different timelines or geographical regions. Patterns are displayed in graphs or charts. Linguists offer their own unique lens to study cookbooks, whereas anthropologists and historians ask what these objects can tell us about how our ancestors lived and drew meaning from life. This process is continuously refined, and each grouping is discussed below. Ingredients The geographic origins of the ingredients are of interest, as is the seasonality and the cost of the foodstuffs within the scope of each cookbook, as well as the sensory quality both separately and combined within different recipes. In the medieval period, the use of spices and large joints of butchers meat and game were symbols of wealth and status. However, when the discovery of sea routes to the New World and to the Far East made spices more available and affordable to the middle classes, the upper classes spurned them. Evidence from culinary manuscripts in Georgian Ireland, for example, suggests that galangal was more easily available in Dublin during the eighteenth century than in the mid-twentieth century. A new aesthetic, articulated by La Varenne in his Le Cuisinier Francois (1651), heralded that food should taste of itself, and so exotic ingredients such as cinnamon, nutmeg, and ginger were replaced by the local bouquet garni, and stocks and sauces became the foundations of French haute cuisine (Mac Con Iomaire). Some combinations of flavours and ingredients were based on humoral physiology, a long held belief system based on the writings of Hippocrates and Galen, now discredited by modern scientific understanding. The four humors are blood, yellow bile, black bile, and phlegm. It was believed that each of these humors would wax and wane in the body, depending on diet and activity. Galen (131-201 AD) believed that warm food produced yellow bile and that cold food produced phlegm. It is difficult to fathom some combinations of ingredients or the manner of service without comprehending the contemporary context within they were consumeSome ingredients found in Roman cookbooks, such as “garum” or “silphium” are no longer available. It is suggested that the nearest substitute for garum also known as “liquamen”—a fermented fish sauce—would be Naam Plaa, or Thai fish sauce (Grainger). Ingredients such as tea and white bread, moved from the prerogative of the wealthy over time to become the staple of the urban poor. These ingredients, therefore, symbolise radically differing contexts during the seventeenth century than in the early twentieth century. Indeed, there are other ingredients such as hominy (dried maize kernel treated with alkali) or grahams (crackers made from graham flour) found in American cookbooks that require translation to the unacquainted non-American reader. There has been a growing number of food encyclopaedias published in recent years that assist scholars in identifying such commodities (Smith, Katz, Davidson). The Cook’s Workplace, Techniques, and Equipment It is important to be aware of the type of kitchen equipment used, the management of heat and cold within the kitchen, and also the gradual spread of the industrial revolution into the domestic sphere. Visits to historic castles such as Hampton Court Palace where nowadays archaeologists re-enact life below stairs in Tudor times give a glimpse as to how difficult and labour intensive food production was. Meat was spit-roasted in front of huge fires by spit boys. Forcemeats and purees were manually pulped using mortar and pestles. Various technological developments including spit-dogs, and mechanised pulleys, replaced the spit boys, the most up to date being the mechanised rotisserie. The technological advancements of two hundred years can be seen in the Royal Pavilion in Brighton where Marie-Antoinin Carême worked for the Prince Regent in 1816 (Brighton Pavilion), but despite the gleaming copper pans and high ceilings for ventilation, the work was still back breaking. Carême died aged forty-nine, “burnt out by the flame of his genius and the fumes of his ovens” (Ackerman 90). Mennell points out that his fame outlived him, resting on his books: Le Pâtissier Royal Parisien (1815); Le Pâtissier Pittoresque (1815); Le Maître d’Hôtel Français (1822); Le Cuisinier Parisien (1828); and, finally, L’Art de la Cuisine Française au Dix-Neuvième Siècle (1833–5), which was finished posthumously by his student Pluméry (All Manners). Mennell suggests that these books embody the first paradigm of professional French cuisine (in Kuhn’s terminology), pointing out that “no previous work had so comprehensively codified the field nor established its dominance as a point of reference for the whole profession in the way that Carême did” (All Manners 149). The most dramatic technological changes came after the industrial revolution. Although there were built up ovens available in bakeries and in large Norman households, the period of general acceptance of new cooking equipment that enclosed fire (such as the Aga stove) is from c.1860 to 1910, with gas ovens following in c.1910 to the 1920s) and Electricity from c.1930. New food processing techniques dates are as follows: canning (1860s), cooling and freezing (1880s), freeze drying (1950s), and motorised delivery vans with cooking (1920s–1950s) (den Hartog). It must also be noted that the supply of fresh food, and fish particularly, radically improved following the birth, and expansion of, the railways. To understand the context of the cookbook, one needs to be aware of the limits of the technology available to the users of those cookbooks. For many lower to middle class families during the twentieth century, the first cookbook they would possess came with their gas or electrical oven. Meals One can follow cooked dishes from the kitchen to the eating place, observing food presentation, carving, sequencing, and serving of the meal and table etiquette. Meal times and structure changed over time. During the Middle Ages, people usually ate two meals a day: a substantial dinner around noon and a light supper in the evening (Adamson). Some of the most important factors to consider are the manner in which meals were served: either à la française or à la russe. One of the main changes that occurred during the nineteenth century was the slow but gradual transfer from service à la française to service à la russe. From medieval times to the middle of the nineteenth century the structure of a formal meal was not by “courses”—as the term is now understood—but by “services”. Each service could comprise of a choice of dishes—both sweet and savoury—from which each guest could select what appealed to him or her most (Davidson). The philosophy behind this form of service was the forementioned humoral physiology— where each diner chose food based on the four humours of blood, yellow bile, black bile, or phlegm. Also known as le grand couvert, the à la française method made it impossible for the diners to eat anything that was beyond arm’s length (Blake, and Crewe). Smooth service, however, was the key to an effective à la russe dinner since servants controlled the flow of food (Eatwell). The taste and temperature of food took centre stage with the à la russe dinner as each course came in sequence. Many historic cookbooks offer table plans illustrating the suggested arrangement of dishes on a table for the à la française style of service. Many of these dishes might be re-used in later meals, and some dishes such as hashes and rissoles often utilised left over components of previous meals. There is a whole genre of cookbooks informing the middle class cooks how to be frugal and also how to emulate haute cuisine using cheaper or ersatz ingredients. The number dining and the manner in which they dined also changed dramatically over time. From medieval to Tudor times, there might be hundreds dining in large banqueting halls. By the Elizabethan age, a small intimate room where master and family dined alone replaced the old dining hall where master, servants, guests, and travellers had previously dined together (Spencer). Dining tables remained portable until the 1780s when tables with removable leaves were devised. By this time, the bread trencher had been replaced by one made of wood, or plate of pewter or precious metal in wealthier houses. Hosts began providing knives and spoons for their guests by the seventeenth century, with forks also appearing but not fully accepted until the eighteenth century (Mason). These silver utensils were usually marked with the owner’s initials to prevent their theft (Flandrin). Cookbooks as Objects and the World of Publishing A thorough examination of the manuscript or printed cookbook can reveal their physical qualities, including indications of post-publication history, the recipes and other matter in them, as well as the language, organization, and other individual qualities. What can the quality of the paper tell us about the book? Is there a frontispiece? Is the book dedicated to an employer or a patron? Does the author note previous employment history in the introduction? In his Court Cookery, Robert Smith, for example, not only mentions a number of his previous employers, but also outlines that he was eight years working with Patrick Lamb in the Court of King William, before revealing that several dishes published in Lamb’s Royal Cookery (1710) “were never made or practis’d (sic) by him and others are extreme defective and imperfect and made up of dishes unknown to him; and several of them more calculated at the purses than the Gôut of the guests”. Both Lamb and Smith worked for the English monarchy, nobility, and gentry, but produced French cuisine. Not all Britons were enamoured with France, however, with, for example Hannah Glasse asserting “if gentlemen will have French cooks, they must pay for French tricks” (4), and “So much is the blind folly of this age, that they would rather be imposed on by a French Booby, than give encouragement to an good English cook” (ctd. in Trubek 60). Spencer contextualises Glasse’s culinary Francophobia, explaining that whilst she was writing the book, the Jacobite army were only a few days march from London, threatening to cut short the Hanoverian lineage. However, Lehmann points out that whilst Glasse was overtly hostile to French cuisine, she simultaneously plagiarised its receipts. Based on this trickling down of French influences, Mennell argues that “there is really no such thing as a pure-bred English cookery book” (All Manners 98), but that within the assimilation and simplification, a recognisable English style was discernable. Mennell also asserts that Glasse and her fellow women writers had an enormous role in the social history of cooking despite their lack of technical originality (“Plagiarism”). It is also important to consider the place of cookbooks within the history of publishing. Albala provides an overview of the immense outpouring of dietary literature from the printing presses from the 1470s. He divides the Renaissance into three periods: Period I Courtly Dietaries (1470–1530)—targeted at the courtiers with advice to those attending banquets with many courses and lots of wine; Period II The Galenic Revival (1530–1570)—with a deeper appreciation, and sometimes adulation, of Galen, and when scholarship took centre stage over practical use. Finally Period III The Breakdown of Orthodoxy (1570–1650)—when, due to the ambiguities and disagreements within and between authoritative texts, authors were freer to pick the ideas that best suited their own. Nutrition guides were consistent bestsellers, and ranged from small handbooks written in the vernacular for lay audiences, to massive Latin tomes intended for practicing physicians. Albala adds that “anyone with an interest in food appears to have felt qualified to pen his own nutritional guide” (1). Would we have heard about Mrs. Beeton if her husband had not been a publisher? How could a twenty-five year old amass such a wealth of experience in household management? What role has plagiarism played in the history of cookbooks? It is interesting to note that a well worn copy of her book (Beeton) was found in the studio of Francis Bacon and it is suggested that he drew inspiration for a number of his paintings from the colour plates of animal carcasses and butcher’s meat (Dawson). Analysing the post-publication usage of cookbooks is valuable to see the most popular recipes, the annotations left by the owner(s) or user(s), and also if any letters, handwritten recipes, or newspaper clippings are stored within the leaves of the cookbook. The Reader, the Cook, the Eater The physical and inner lives and needs and skills of the individuals who used cookbooks and who ate their meals merit consideration. Books by their nature imply literacy. Who is the book’s audience? Is it the cook or is it the lady of the house who will dictate instructions to the cook? Numeracy and measurement is also important. Where clocks or pocket watches were not widely available, authors such as seventeenth century recipe writer Sir Kenelm Digby would time his cooking by the recitation of the Lord’s Prayer. Literacy amongst protestant women to enable them to read the Bible, also enabled them to read cookbooks (Gold). How did the reader or eater’s religion affect the food practices? Were there fast days? Were there substitute foods for fast days? What about special occasions? Do historic cookbooks only tell us about the food of the middle and upper classes? It is widely accepted today that certain cookbook authors appeal to confident cooks, while others appeal to competent cooks, and others still to more cautious cooks (Bilton). This has always been the case, as has the differentiation between the cookbook aimed at the professional cook rather than the amateur. Historically, male cookbook authors such as Patrick Lamb (1650–1709) and Robert Smith targeted the professional cook market and the nobility and gentry, whereas female authors such as Eliza Acton (1799–1859) and Isabella Beeton (1836–1865) often targeted the middle class market that aspired to emulate their superiors’ fashions in food and dining. How about Tavern or Restaurant cooks? When did they start to put pen to paper, and did what they wrote reflect the food they produced in public eateries? Conclusions This paper has offered an overview of Barbara Ketchum Wheaton’s methodology for reading historic cookbooks using a structured approach. It has highlighted some of the questions scholars and researchers might ask when faced with an old cookbook, regardless of era or geographical location. By systematically examining the book under the headings of ingredients; the cook’s workplace, techniques and equipment; the meals; cookbooks as objects and the world of publishing; and reader, cook and eater, the scholar can perform magic and extract much more from the cookbook than seems to be there on first appearance. References Ackerman, Roy. The Chef's Apprentice. London: Headline, 1988. Adamson, Melitta Weiss. Food in Medieval Times. Westport, Connecticut: Greenwood P, 2004. Albala, Ken. Eating Right in the Renaissance. Ed. Darra Goldstein. Berkeley: U of California P, 2002. Beeton, Isabella. Beeton's Book of Household Management. London: S. Beeton, 1861. Bilton, Samantha. “The Influence of Cookbooks on Domestic Cooks, 1900-2010.” Petit Propos Culinaires 94 (2011): 30–7. Blake, Anthony, and Quentin Crewe. Great Chefs of France. London: Mitchell Beazley/ Artists House, 1978. Brighton Pavilion. 12 Jun. 2013 ‹http://www.guardian.co.uk/artanddesign/interactive/2011/sep/09/brighton-pavilion-360-interactive-panoramic›. Cashman, Dorothy. “An Exploratory Study of Irish Cookbooks.” Unpublished Master's Thesis. M.Sc. Dublin: Dublin Institute of Technology, 2009. Chartier, Roger. “The Practical Impact of Writing.” Trans. Arthur Goldhammer. A History of Private Lives: Volume III: Passions of the Renaissance. Ed. Roger Chartier. Cambridge, Massachusetts: Belknap P of Harvard U, 1989. 111-59. Davidson, Alan. The Oxford Companion to Food. New York: Oxford U P, 1999. Dawson, Barbara. “Francis Bacon and the Art of Food.” The Irish Times 6 April 2013. den Hartog, Adel P. “Technological Innovations and Eating out as a Mass Phenomenon in Europe: A Preamble.” Eating out in Europe: Picnics, Gourmet Dining and Snacks since the Late Eighteenth Century. Eds. Mark Jacobs and Peter Scholliers. Oxford: Berg, 2003. 263–80. Eatwell, Ann. “Á La Française to À La Russe, 1680-1930.” Elegant Eating: Four Hundred Years of Dining in Style. Eds. Philippa Glanville and Hilary Young. London: V&A, 2002. 48–52. Flandrin, Jean-Louis. “Distinction through Taste.” Trans. Arthur Goldhammer. A History of Private Lives: Volume III : Passions of the Renaissance. Ed. Roger Chartier. Cambridge, Massachusetts: Belknap P of Harvard U, 1989. 265–307. Folch, Christine. “Fine Dining: Race in Pre-revolution Cuban Cookbooks.” Latin American Research Review 43.2 (2008): 205–23. Glasse, Hannah. The Art of Cookery Made Plain and Easy; Which Far Exceeds Anything of the Kind Ever Published. 4th Ed. London: The Author, 1745. Gold, Carol. Danish Cookbooks: Domesticity and National Identity, 1616-1901. Seattle: U of Washington P, 2007. Grainger, Sally. Cooking Apicius: Roman Recipes for Today. Totnes, Devon: Prospect, 2006. Hampton Court Palace. “The Tudor Kitchens.” 12 Jun 2013 ‹http://www.hrp.org.uk/HamptonCourtPalace/stories/thetudorkitchens› Katz, Solomon H. Ed. Encyclopedia of Food and Culture (3 Vols). New York: Charles Scribner’s Sons, 2003. Kuhn, T. S. The Structure of Scientific Revolutions. Chicago: U of Chicago P, 1962. Lamb, Patrick. Royal Cookery:Or. The Complete Court-Cook. London: Abel Roper, 1710. Lehmann, Gilly. “English Cookery Books in the 18th Century.” The Oxford Companion to Food. Ed. Alan Davidson. Oxford: Oxford U P, 1999. 277–9. Mac Con Iomaire, Máirtín. “The Changing Geography and Fortunes of Dublin’s Haute Cuisine Restaurants 1958–2008.” Food, Culture & Society 14.4 (2011): 525–45. Mac Con Iomaire, Máirtín, and Dorothy Cashman. “Irish Culinary Manuscripts and Printed Cookbooks: A Discussion.” Petit Propos Culinaires 94 (2011): 81–101. Mason, Laura. Food Culture in Great Britain. Ed. Ken Albala. Westport CT.: Greenwood P, 2004. Mennell, Stephen. All Manners of Food. 2nd ed. Chicago: U of Illinois P, 1996. ---. “Plagiarism and Originality: Diffusionism in the Study of the History of Cookery.” Petits Propos Culinaires 68 (2001): 29–38. Sherman, Sandra. “‘The Whole Art and Mystery of Cooking’: What Cookbooks Taught Readers in the Eighteenth Century.” Eighteenth Century Life 28.1 (2004): 115–35. Smith, Andrew F. Ed. The Oxford Companion to American Food and Drink. New York: Oxford U P, 2007. Spencer, Colin. British Food: An Extraordinary Thousand Years of History. London: Grub Street, 2004. Tierney, Mark. Europe and the World 1300-1763. Dublin: Gill and Macmillan, 1970. Trubek, Amy B. Haute Cuisine: How the French Invented the Culinary Profession. Philadelphia: U of Pennsylvania P, 2000. Wheaton, Barbara. “Finding Real Life in Cookbooks: The Adventures of a Culinary Historian”. 2006. Humanities Research Group Working Paper. 9 Sep. 2009 ‹http://www.phaenex.uwindsor.ca/ojs/leddy/index.php/HRG/article/view/22/27›. Wheaton, Barbara Ketcham. Savouring the Past: The French Kitchen and Table from 1300-1789. London: Chatto & Windus, 1983. White, Eileen, ed. The English Cookery Book: Historical Essays. Proceedings of the 16th Leeds Symposium on Food History 2001. Devon: Prospect, 2001.

The word “prosthetic” has its origins as a mathematical term. According to scholar Brandon W. Hawk, Plato uses the words prosthesis and prostithenai in Phaedo to mean "addition, add to, to place", and Aristotle uses it in a similar, algebraic sense in the Metaphysics. Later, as the word appears in classical Latin, it is used as a grammatical and rhetorical term, in the sense of a letter or syllable that is added on to a word, usually the addition of a syllable to the beginning of a word, hence pro-thesis (Hawk). This is the sense of the word that was “inherited … by early modern humanists”, says Hawk, but when it appears in Edward Phillips's The New World of English Words: Or, a General Dictionary (1706), we can see how, with advances in technology, it changes from a grammatical/linguistic term into a medical term. What was once word is now made flesh:Prosthesis, a Grammatical Figure, when a Letter or Syllable is added to the beginning of a Word, as Gnatus for natus, tetuli for tuli, &c. In Surgery, Prosthesis is taken for that which fills up what is wanting, as is to beseen in fistulous and hollow Ulcers, filled up with Flesh by that Art: Also themaking of artificial Legs and Arms, when the natural ones are lost.Hawk also points to P. Dionis in Course Chirurg (a 1710 textbook detailing the art of chirurgy, or surgery, as it’s known now), who uses the word to denote one type of surgical operation; that is, prosthesis becomes not a word, but an act that “adds what is deficient”, an act that repairs loss, that “fills up what is wanting”, that fills up what is “hollow”, that “fills up with flesh”. R. Brookes, in his Introduction to Physic and Surgery (1754), is the first to define prosthesis as both an act and also as a separate, material object; it is “an operation by which some instrument is added to supply the Defect of a Part which is wanting, either naturally or accidentally”. It is not until the twentieth century (1900, to be exact), though, that the word begins to refer solely to a device or object that is added on to somehow “supply the defect”, or fill up what which is “wanting”. So etymologically we move from the writer creating a new literary device, to the scientist/doctor acting in order to fix something, then back to the device again, this time as tangible object that fills a gap where there is lack and loss (Hawk).This is how we most often see the word, and so we have the notion of prosthetic used in this medicalised sense, as an "instrument", in relation to people with missing or disfunctional limbs. Having a prosthetic arm or leg in an ableist society instantly marks one as "missing" something, or being "disabled". Wheelchairs and other prosthetic accoutrements also serve as a metonymic shorthand for disability (an example of this might be how, on reserved parking spots in North America, the image on the sign is that of a person in a wheelchair). In the case of deaf people, who are also thought of as "disabled", but whose supposed disability is invisible, hearing aids and cochlear implants (CIs) serve as this kind of visible marker.* Like artificial limbs and wheelchairs, these "instruments" (they are actually called “hearing instruments” by audiologists) are sometimes added on to the purportedly “lacking” body. They are objects that “restore function to” the disabled deaf ear. As such, these devices, like wheelchairs and bionic arms, also serve as a shorthand in American culture, especially in film and visual media, where this kind of obvious, material symbolism is very helpful in efficiently driving narrative along. David L. Mitchell and Sharon T. Snyder call this kind of disability shorthand "narrative prosthesis". In their 2001 book of the same name, they demonstrate that disability and the markers of disability, far from being neglected or omitted (as has been claimed by critics like Sarah Ruiz-Grossman), actually appear in literature and film to the point where they are astonishingly pervasive. Unlike other identities who are vastly underrepresented, Mitchell and Snyder note, images of disability are almost constantly circulated in print and visual media (this is clearly demonstrated in older film studies such as John Schuchman's Hollywood Speaks and Martin Norden's Cinema of Isolation, as well). The reason that this happens, Mitchell and Snyder say, is because almost all narrative is structured around the idea of a flaw in the natural order, the resolution of that flaw, and the restoration of order. This flaw, they show, is more often than not represented by a disabled character or symbol. Disability, then, is a "crutch upon which literary narratives lean for their representational power, disruptive potentiality and analytical insight" (49). And, in the end, all narrative is thus dependent upon some type of disability used as a prosthetic, which serves not only to “fill in” lack, but also to restore and reinforce normalcy. They also state that concepts of, and characters with, disability are therefore used in literature and film primarily as “opportunist metaphorical device(s)” (205). Hearing aids and CIs are great examples of "opportunist" devices used on television and in movies, mostly as props or “add-ons” in visual narratives. This "adding on" is done, more often than not, to the detriment of providing a well rounded narrative about the lived experience of deaf people who use such devices on a daily basis. There are countless examples of this in American television shows and films (in an upward trend since 2000), including many police and crime dramas where a cochlear implant device-as-clue stands in for the dead victim’s identity (Kincheloe "Do Androids"). We see it in movies, most notably in 2018’s A Quiet Place, in which a CI is weaponized and used to defeat the alien monster/Other (as opposed to the deaf heroine doing it by herself) (Kincheloe "Tired Tropes"). In 2019's Toy Story 4, there is a non-signing child who we know is deaf because they wear a CI. In the 2019 animated Netflix series, Undone, the main character wears a CI, and it serves as one of several markers (for her and the viewer) of her possible psychological breakdown.It seems fairly obvious that literal prostheses such as hearing aids and CI devices are used as a form of media shorthand to connote hearing ideas of “deafness”. It also might seem obvious that, as props that reinforce mainstream, ableist narratives, they are there to tell us that, in the end, despite the aesthetic nervousness that disability produces, "things will be okay". It's "fixable". These are prosthetics that are easily identified and easily discussed, debated, and questioned.What is perhaps not so obvious, however, is that American Sign Language (ASL), is also used in media as a narrative prosthetic. Lennard Davis' discussion of Erving Goffman’s idea of “stigma” in Enforcing Normalcy supports the notion that sign language, like hearing aids, is a marker. When seen by the hearing, non-signing observer, sign language "stigmatizes" the signing deaf person (48). In this sense, ASL is, like a hearing aid, a tangible "sign" of deaf identity. I would then argue that ASL is, like hearing aids and CIs, used as a "narrative prosthesis" signifying deafness and disability; its insertion allows ableist narratives to be satisfyingly resolved. Even though ASL is not a static physical device, but a living language and an integral part of deaf lived experience, it is casually employed almost everywhere in media today as a cheap prop, and as such, serves narrative purposes that are not in the best interest of realistic deaf representation. Consider this example: On 13 April 2012, Sir Paul McCartney arranged for a special event at his daughter Stella McCartney’s ivy-covered store in West Hollywood. Stars and friends like Jane Fonda, Gwyneth Paltrow, Chris Martin, Quincy Jones, and Reese Witherspoon sipped cucumber margaritas and nibbled on a spread of vegetarian Mexican appetizers. Afterwards, McCartney took them all to a tent set up on the patio out back, where he proudly introduced a new video, directed by himself. This was the world premiere of the video for "My Valentine", a song from his latest (some might say oddly titled) album, Kisses from the Bottom, a song he had originally written for and sung to new wife Nancy Shevell, at their 2011 wedding.The video is very simply shot in black and white, against a plain grey backdrop. As it begins, the camera fades in on actor Natalie Portman, who is seated, wearing a black dress. She stares at the viewer intently, but with no expression. As McCartney’s voiced-over vocal begins, “What if it rained/We didn’t care…”, she suddenly starts to mouth the words, and using sign language. The lens backs up to a medium shot of her, then closes back in on a tight close up of just her hands signing “my valentine” on her chest. There is then a quick cut to actor Johnny Depp, who is sitting in a similar position, in front of a grey backdrop, staring directly at the camera, also with no expression. There is a fade back to Portman’s face, then to her body, a close up of her signing the word “appear”, and then a cut back to Depp. Now he starts signing. Unlike Portman, he does not mouth the words, but stares ahead, with no facial movement. There is then a series of jump cuts, back and forth, between shots of the two actors’ faces, eyes, mouths, hands. For the solo bridge, there is a closeup on Depp’s hands playing guitar – a cut to Portman’s face, looking down – then to her face with eyes closed as she listens. here is some more signing, we see Depp’s impassive face staring at us again, and then, at the end, the video fades out on Portman’s still figure, still gazing at us as well.McCartney told reporters that Stella had been the one to come up with the idea for using sign language in the video. According to the ASL sign language coach on the shoot, Bill Pugin, the choice to include it wasn’t that far-fetched: “Paul always has an interpreter on a riser with a spot for his concerts and Stella loves sign language, apparently” ("The Guy Who Taught Johnny Depp"). Perhaps she made the suggestion because the second stanza contains the words “I tell myself that I was waiting for a sign…” Regardless, McCartney advised her father to “ring Natalie up and just ask her if she will sign to your song”. Later realizing he wanted another person signing in the video, Paul McCartney asked Johnny Depp to join in, which he did. When asked why he chose those two actors, McCartney said, “Well, they’re just nice people, some friends from way back and they were just very kind to do it”. A week later, they all got together with cinematographer Wally Pfister, who filmed Inception and The Dark Knight, behind the camera. According to the official press release about the video, posted on McCartney’s website, the two actors then "translate[d] the lyrics of the song into sign language – each giving distinctly different performances, making ... compelling viewing" ("Paul McCartney Directs His Own"). The response to the video was quite positive; it immediately went viral on YouTube (the original posting of it got over 15 million views). The album made it to number five on the Billboard charts, with the single reaching number twenty. The album won a 2013 Grammy Award for Best Traditional Pop Vocal album, and the video Best Music Film (“Live Kisses”). McCartney chose to sing that particular song from the album on the award show itself, and four years later, he featured both the song and video as part of his 31 city tour, the 2017 One on One concert, in which he made four million dollars a city. All told the video has served McCartney quite well.But…For whom the sign language? And why? The video is not meant for deaf eyes. When viewed through a deaf lens, it is not, by any stretch of the imagination, “compelling”; it isn’t even comprehensible. It is so bad, in fact, that the video, though signed, is also captioned for the deaf and hard of hearing. To the untrained, “hearing” eye, the signing seems to be providing a “deaf translation” of what is being sung. But it is in fact a pantomime. The actors are quite literally “going through the motions”. One egregious example of this is how, at the end of the video, when Depp thinks he’s signing “valentine”. it looks like he's saying “fuck-heart” (several media sources politely reported that he’d signed “enemy”). Whatever he did, it’s not a sign. In response to criticism of his signing, Depp said nonchalantly, “Apparently, instead of ‘love' I might have said, ‘murder'” ("Johnny Depp Says"). That wasn’t the only point of confusion, though: the way Portman signs “then she appears” was misunderstood by some viewers to be the sign for “tampon”. She actually signed it correctly, but media sources from MTV.com, to the Washington Post, “signsplained” that she had just gotten a bit confused between ASL and BSL signs (even though the BSL for “appears” bears no resemblance to what she did, and the ASL for tampon, while using the same classifier, is also signed quite differently). Part of the problem, according to sign coach Pugin, was that he and Depp “had about fifteen minutes to work on the song. I signed the song for hours sitting on an apple box under the camera for Johnny to be able to peripherally see me for each take. I was his “human cue card”. Johnny’s signing turned out to be more theatrical and ‘abbreviated’ because of the time issue” ("The Guy Who Taught").Portman, perhaps taking more time to rehearse, does a better job, but “theatrical and abbreviated” indeed; the signing was just not good, despite Pugin's coaching. But to hearing eyes, it looks fine; it looks beautiful, it looks poignant and somehow mysterious. It looks the way sign language is “supposed” to look.Remember, the McCartney website claimed that the actors were “translating” the lyrics. Technically speaking, “translation” would mean that the sense of the words to the song were being rendered, fluently, from one language (English) into another (SL), for an audience receptive to the second language. In order to “translate”, the translator needs to be fluent in both of the languages involved. To be clear, what Depp and Portman were doing was not translation. They are hearing people, not fluent in sign language, acting like signers (something that happens with dismaying regularity in the entertainment industry). Depp, to his credit, knew he wasn’t “translating”, in fact, he said "I was only copying what the guy showed me”. “But”, he says, "it was a gas – sign language is apparently very interpretive. It's all kind of different" (italics mine) ("Johnny Depp Passes the Buck"). Other than maybe being an embellishment on that one line, “I tell myself that I was waiting for a sign…”, the sentiments of McCartney’s song have absolutely nothing to do with ASL or deaf people. And he didn’t purposefully place sign language in his video as a way to get his lyrics across to a deaf audience. He’s a musician; it is fairly certain that the thought of appealing to a deaf audience never entered his or his daughter’s mind. It is much more likely that he made the decision to use sign language because of its cool factor; its emo “novelty”. In other words, McCartney used sign language as a prop – as a way to make his song “different”, more “touching”, more emotionally appealing. Sign adds a je ne sais quoi, a little “something”, to the song. The video is a hearing person’s fantasy of what a signing person looks like, what sign language is, and what it does. McCartney used that fantasy, and the sentimentality that it evokes, to sell the song. And it worked. This attitude toward sign language, demonstrated by the careless editing of the video, Depp’s flippant remarks, and the overall attitude that if it’s wrong it’s no big deal, is one that is pervasive throughout the entertainment and advertising industries and indeed throughout American culture in the U.S. That is, there is this notion that sign language is “a gas”. It’s just a “different” thing. Not only is it “different”, but it is also a “thing”, a prop, a little exotic spice you throw into the pot. It is, in other words, a "narrative prosthesis", an "add-on". Once you see this, it becomes glaringly apparent that ASL is not viewed in mainstream American culture as the language of a group of people, but instead is widely used and commodified as a product. The most obvious form of commodification is in the thousands of ASL products, from Precious Moment figurines, to Baby Signing videos, to the ubiquitous “I LOVE YOU” sign seen on everything from coffee mugs to tee shirts, to Nike posters with “Just Do It” in fingerspelling. But the area in which the language is most often commodified (and perhaps most insidiously so) is in the entertainment industry, in visual media, where it is used by writers, directors and actors, not to present an accurate portrait of lived deaf experience and language, but to do what Paul McCartney did, that is, to insert it just to create a “different”, unique, mysterious, exotic, heartwarming spectacle. Far too often, this commodification of the language results in weirdly distorted representations of what deaf people and their language actually are. You can see this everywhere: ASL is a prominent narrative add-on in blockbuster films like the aforementioned A Quiet Place; it is used in the Oscar winning The Shape of Water, and in Wonderstruck, and Baby Driver as well; it is used in the indie horror film Hush; it is used in a lot of films with apes (the Planet of the Apes series and Rampage are two examples); it is displayed on television, mostly in police dramas, in various CSI programs, and in series like The Walking Dead and Castle Rock; it is used in commercials to hawk everything from Pepsi to hotel chains to jewelry to Hormel lunchmeat to fast food (Burger King, Chik Fil A); it is used and commented on in interpreted concerts and music videos and football halftime shows; it is used (often misused) in PSAs for hurricanes and police stops; it is used in social media, from vlogs to cochlear implant activation videos. You can find ASL seemingly everywhere; it is being inserted more and more into the cultural mainstream, but is not appearing as a language. It is used, nine times out of ten, as a decorative ornament, a narrative prop. When Davis discusses the hearing perception of ASL as a marker or visible stigma, he points out that the usual hearing response to observing such stigma is a combination of a Freudian attraction/repulsion (the dominant response being negative). Many times this repulsion results from the appeal to pathos, as in the commercials that show the poor isolated deaf person with the nice hearing person who is signing to them so that they can now be part of the world. The hearing viewer might think to themselves "oh, thank God I'm not deaf!"Davis notes that, in the end, it is not the signer who is the disabled one in this scenario (aside from the fact that many times a signing person is not in fact deaf). The hearing, non signing observer is actually the one “disabled” by their own reaction to the signing “other”. Not only that, but the rhetorical situation itself becomes “disabled”: there is discomfort – wariness of language – laughter – compulsive nervous talking – awkwardness – a desire to get rid of the object. This is a learned response. People habituated, Davis says, do not respond this way (12-13). While people might think that the hearing audience is becoming more and more habituated because ASL is everywhere, the problem is that people are being incorrectly habituated. More often than not, sign language, when enfolded into narratives about hearing people in hearing situations, is put into service as a prop that can mitigate such awkward moments of possible tension and conflict; it is a prosthetic that "fills the gap", allowing an interaction between hearing and deaf people that almost always allows for a positive, "happy" resolution, a return to "normalcy", the very purpose of the "narrative prosthetic" as posited by Mitchell and Snyder. Once we see how ASL is being employed in media mostly as a narrative prosthesis, we can, as Mitchell and Snyder suggest we do (what I hope this essay begins to do), and that is, to begin to “undo the quick repair of disability in mainstream representations and beliefs; to try to make the prosthesis show; to flaunt its imperfect supplementation as an illusion” (8). In other words, if we can scrutinize the shorthand, and dig deeper, seeing the prosthetic for what it is, all of this seemingly exploitative commodification of ASL will be a good thing. Maybe, in “habituating” people correctly, in widening both hearing people’s exposure to ASL and their understanding of its actual role in deaf lived experience, signing will become less of a prosthetic, an object of fetishistic fascination. Maybe hearing people, as they become used to seeing signing people in real signing situations, will be less likely to walk up to deaf people they don’t know and say things like: “Oh, your language is SO beautiful”, or say, “I know sign!” (then fingerspelling the alphabet with agonising slowness and inaccuracy while the deaf person nods politely). However, if the use of ASL as a prosthetic in popular culture and visual media continues to go on unexamined and unquestioned, it will just continue to trivialise a living, breathing language. This trivialisation can in turn continue to reduce the lived experiences of deaf people to a sort of caricature, further reinforcing the negative representations of deaf people in America that are already in place, stereotypes that we have been trying to escape for over 200 years. Note* The word "deaf" is used in this article to denote the entire range of individuals with various hearing losses and language preferences, including Deaf persons and hard of hearing persons, etc. For more on these distinctions please refer to the website entry on this published by the National Association of the Deaf (NAD).ReferencesDavis, Lennard. Enforcing Normalcy. New York: Verso, 1995."The Guy Who Taught Johnny Depp and Natalie Portman Sign Language." Intimate Excellent: The Fountain Theater Blog. 18 Mar. 2012. <https://intimateexcellent.com/2012/04/18/the-guy-who-taught-johnny-depp-and-natalie-portman-sign-language-in-mccartney-video/>.Fitzgerald, Roisin. "Johnny Depp Says Sign Language Mishap Isn't His Fault." HiddenHearing Blog 14 Apr. 2012. <https://hiddenhearingireland.wordpress.com/2012/05/29/johnny-depp-says-sign-language-mishap-isnt-his-fault/>.Hawk, Brandon W. “Prosthesis: From Grammar to Medicine in the Earliest History of the Word.” Disability Studies Quarterly 38.4 (2018).McCartney, Paul. "My Valentine." YouTube 13 Apr. 2012.McGinnis, Sara. "Johnny Depp Passes the Buck on Sign Language Snafu." sheknows.com 10 May 2012. <https://www.sheknows.com/entertainment/articles/959949/johnny-depp-passes-the-buck-on-sign-language-snafu/>.Miller, Julie. "Paul McCartney on Directing Johnny Depp and Natalie Portman." Vanity Fair 14 Apr. 2012. <https://www.vanityfair.com/style/2012/04/paul-mccartney-johnny-depp-natalie-portman-my-valentine-music-video-gwyneth-paltrow>.Mitchell, David T., and Sharon L. Snyder. Narrative Prosthesis: Disabilities and the Dependencies of Discourse. Ann Arbor: U of Michigan P. 2000.Norden, Martin. F. The Cinema of Isolation: A History of Physical Disability in Movies. Rutgers UP: 1994."Paul McCartney Directs His Own My Valentine Video." paulmccartney.com 14 Apr. 2012. <https://www.paulmccartney.com/news-blogs/news/paul-mccartney-directs-his-own-my-valentine-videos-featuring-natalie-portman-and>.Ruiz-Grossman, Sarah. "Disability Representation Is Seriously Lacking in Television and the Movies: Report." Huffington Post 27 Mar. 2019. <https://www.huffpost.com/entry/disability-representation-movies-tv_n_5c9a7b85e4b07c88662cabe7>.Schuchman, J.S. Hollywood Speaks: Deafness and the Film Entertainment Industry. U Illinois P, 1999.