Увійти

Готові списки джерел за темами / Detection of food adulteration / Статті в журналах

Статті в журналах з теми "Detection of food adulteration"

Щоб переглянути інші типи публікацій з цієї теми, перейдіть за посиланням: Detection of food adulteration.

Автор: Grafiati

Опубліковано: 13 вересня 2021

Оновлено: 1 лютого 2022

Оформте джерело за APA, MLA, Chicago, Harvard та іншими стилями

Оберіть тип джерела:

Ознайомтеся з топ-50 статей у журналах для дослідження на тему "Detection of food adulteration".

Біля кожної праці в переліку літератури доступна кнопка «Додати до бібліографії». Скористайтеся нею – і ми автоматично оформимо бібліографічне посилання на обрану працю в потрібному вам стилі цитування: APA, MLA, «Гарвард», «Чикаго», «Ванкувер» тощо.

Також ви можете завантажити повний текст наукової публікації у форматі «.pdf» та прочитати онлайн анотацію до роботи, якщо відповідні параметри наявні в метаданих.

Переглядайте статті в журналах для різних дисциплін та оформлюйте правильно вашу бібліографію.

1

Mburu, Monica, Clement Komu, Olivier Paquet-Durand, Bernd Hitzmann, and Viktoria Zettel. "Chia Oil Adulteration Detection Based on Spectroscopic Measurements." Foods 10, no. 8 (August 4, 2021): 1798. http://dx.doi.org/10.3390/foods10081798.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Chia oil is a valuable source of omega-3-fatty acids and other nutritional components. However, it is expensive to produce and can therefore be easily adulterated with cheaper oils to improve the profit margins. Spectroscopic methods are becoming more and more common in food fraud detection. The aim of this study was to answer following questions: Is it possible to detect chia oil adulteration by spectroscopic analysis of the oils? Is it possible to identify the adulteration oil? Is it possible to determine the amount of adulteration? Two chia oils from local markets were adulterated with three common food oils, including sunflower, rapeseed and corn oil. Subsequently, six chia oils obtained from different sites in Kenya were adulterated with sunflower oil to check the results. Raman, NIR and fluorescence spectroscopy were applied for the analysis. It was possible to detect the amount of adulterated oils by spectroscopic analysis, with a minimum R2 of 0.95 for the used partial least square regression with a maximum RMSEPrange of 10%. The adulterations of chia oils by rapeseed, sunflower and corn oil were identified by classification with a median true positive rate of 90%. The training accuracies, sensitivity and specificity of the classifications were over 90%. Chia oil B was easier to detect. The adulterated samples were identified with a precision of 97%. All of the classification methods show good results, however SVM were the best. The identification of the adulteration oil was possible; less than 5% of the adulteration oils were difficult to detect. In summary, spectroscopic analysis of chia oils might be a useful tool to identify adulterations.

2

Fiorani, Luca, Florinda Artuso, Isabella Giardina, Antonia Lai, Simone Mannori, and Adriana Puiu. "Photoacoustic Laser System for Food Fraud Detection." Sensors 21, no. 12 (June 18, 2021): 4178. http://dx.doi.org/10.3390/s21124178.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Economically motivated adulterations of food, in general, and spices, in particular, are an emerging threat to world health. Reliable techniques for the rapid screening of counterfeited ingredients in the supply chain need further development. Building on the experience gained with CO2 lasers, the Diagnostic and Metrology Laboratory of ENEA realized a compact and user-friendly photoacoustic laser system for food fraud detection, based on a quantum cascade laser. The sensor has been challenged with saffron adulteration. Multivariate data analysis tools indicated that the photoacoustic laser system was able to detect adulterants at mass ratios of 2% in less than two minutes.

3

Čapla, Jozef, Peter Zajác, Jozef Čurlej, Ľubomír Belej, Miroslav Kročko, Marek Bobko, Lucia Benešová, Silvia Jakabová, and Tomáš Vlčko. "Procedures for the identification and detection of adulteration of fish and meat products." Potravinarstvo Slovak Journal of Food Sciences 14 (October 28, 2020): 978–94. http://dx.doi.org/10.5219/1474.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

The addition or exchange of cheaper fish species instead of more expensive fish species is a known form of fraud in the food industry. This can take place accidentally due to the lack of expertise or act as a fraud. The interest in detecting animal species in meat products is based on religious demands (halal and kosher) as well as on product adulterations. Authentication of fish and meat products is critical in the food industry. Meat and fish adulteration, mainly for economic pursuit, is widespread and leads to serious public health risks, religious violations, and moral loss. Economically motivated adulteration of food is estimated to create damage of around € 8 to 12 billion per year. Rapid, effective, accurate, and reliable detection technologies are keys to effectively supervising meat and fish adulteration. Various analytical methods often based on protein or DNA measurements are utilized to identify fish and meat species. Although many strategies have been adopted to assure the authenticity of fish and meat and meat a fish products, such as the protected designation of origin, protected geographical indication, certificate of specific characteristics, and so on, the coverage is too small, and it is unrealistic to certify all meat products for protection from adulteration. Therefore, effective supervision is very important for ensuring the suitable development of the meat industry, and rapid, effective, accurate, and reliable detection technologies are fundamental technical support for this goal. Recently, several methods, including DNA analysis, protein analysis, and fat-based analysis, have been effectively employed for the identification of meat and fish species.

4

HABZA-KOWALSKA, EWA, MAŁGORZATA GRELA, MAGDALENA GRYZIŃSKA, and PIOTR LISTOS. "Molecular techniques for detecting food adulteration." Medycyna Weterynaryjna 75, no. 05 (2020): 6260–2020. http://dx.doi.org/10.21521/mw.6261.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Food adulteration means that substances have been added to food that change its composition and reduce its nutritional value. Food adulteration also includes giving a product a misleading name, providing false information on its composition, date of production or expiry date, and any other incorrect labelling. Numerous cases of food adulteration have been recorded in many countries, including Poland. This has led to the creation of a new field of science, known as ‘green criminology’, to combat violations of food law. Over the years, new techniques for identifying food adulterations have been developed. Originally, these were sensory techniques, which proved unreliable. Later, physical analysis of the product was performed on the basis of information on the label and microscopic examination. Later methods, based on identification of lipids and proteins, were also unreliable due to biochemical changes during processing. These problems prompted scientists to become interested in the potential of DNA testing. Due the stability of DNA and the universal applicability of DNA-based methods to all cells, they are ideal for use in practice. Currently, the most reliable test for detecting food adulteration is PCR, as it is a highly sensitive and specific technique.

5

Menon, K. I. Ajay, Pranav S, Sachin Govind, and Yadhukrishna Madhu. "RF SENSOR FOR FOOD ADULTERATION DETECTION." Progress In Electromagnetics Research Letters 93 (2020): 137–42. http://dx.doi.org/10.2528/pierl20090103.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

6

González-Domínguez, Sayago, Morales, and Fernández-Recamales. "Assessment of Virgin Olive Oil Adulteration by a Rapid Luminescent Method." Foods 8, no. 8 (July 25, 2019): 287. http://dx.doi.org/10.3390/foods8080287.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

The adulteration of virgin olive oil with hazelnut oil is a common fraud in the food industry, which makes mandatory the development of accurate methods to guarantee the authenticity and traceability of virgin olive oil. In this work, we demonstrate the potential of a rapid luminescent method to characterize edible oils and to detect adulterations among them. A regression model based on five luminescent frequencies related to minor oil components was designed and validated, providing excellent performance for the detection of virgin olive oil adulteration.

7

Borková, M., and J. Snášelová. "Possibilities of different animal milk detection in milk and dairy products – a review." Czech Journal of Food Sciences 23, No. 2 (November 15, 2011): 41–50. http://dx.doi.org/10.17221/3371-cjfs.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Adulteration of milk and dairy products with different types of milk, other than declared, presents a big problem for food monitoring. The evidence of milk adulteration is a difficult task considering similar compositions of various types of milk. The presented review is therefore focused on the study of the composition of milk from different animal species. The aim is to find a useful marker component for the adulterant detection. The analysis of milk proteins is a suitable solution of this problem. The techniques used for research in this area were also studied. As prospective techniques, immunological techniques and techniques based on DNA analysis are especially considered. The first ones are able to determine 0.5% of different milk adulterant, and the second ones even as little as 0.1%. Reverse-phase high-performance liquid chromatography is successfully applied in the quantitative analysis of individual milk adulterants in samples. The most frequent adulteration of ewe and goat milk is its replacement with less expensive and more plentiful bovine milk. Not so typical adulteration is the presence of goat milk in ewe milk or the detection of bovine milk as adulterant in buffalo mozzarella cheese.  

8

Banti, Misgana. "Food Adulteration and Some Methods of Detection, Review." International Journal of Nutrition and Food Sciences 9, no. 3 (2020): 86. http://dx.doi.org/10.11648/j.ijnfs.20200903.13.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

9

Bansal, Sangita, Apoorva Singh, Manisha Mangal, Anupam K. Mangal, and Sanjiv Kumar. "Food adulteration: Sources, health risks, and detection methods." Critical Reviews in Food Science and Nutrition 57, no. 6 (June 9, 2015): 1174–89. http://dx.doi.org/10.1080/10408398.2014.967834.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

10

Inamdar, Prof S. Y. "IoT Based Milk Adulteration Analyser." International Journal for Research in Applied Science and Engineering Technology 9, no. VII (July 30, 2021): 2492–95. http://dx.doi.org/10.22214/ijraset.2021.36908.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Food safety is a more important issue in rural and urban areas as it affects the health of the citizens. Different studies have shown that adulteration of milk is a problem in many countries. Increased adulteration in milk poses a health risk that can lead to life-threatening diseases. So it is necessary to develop a device that allows detection of such life-threatening adulterants present in milk. This is achieved by detecting adulterants in milk using basic principle of spectrometer combined with automated devices.

11

EVERSTINE, KAREN, JOHN SPINK, and SHAUN KENNEDY. "Economically Motivated Adulteration (EMA) of Food: Common Characteristics of EMA Incidents." Journal of Food Protection 76, no. 4 (April 1, 2013): 723–35. http://dx.doi.org/10.4315/0362-028x.jfp-12-399.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Economically motivated adulteration (EMA) of food, also known as food fraud, is the intentional adulteration of food for financial advantage. A common form of EMA, undeclared substitution with alternative ingredients, is usually a health concern because of allergen labeling requirements. As demonstrated by the nearly 300,000 illnesses in China from melamine adulteration of infant formula, EMA also has the potential to result in serious public health consequences. Furthermore, EMA incidents reveal gaps in quality assurance testing methodologies that could be exploited for intentional harm. In contrast to foodborne disease outbreaks, EMA incidents present a particular challenge to the food industry and regulators because they are deliberate acts that are intended to evade detection. Large-scale EMA incidents have been described in the scientific literature, but smaller incidents have been documented only in media sources. We reviewed journal articles and media reports of EMA since 1980. We identified 137 unique incidents in 11 food categories: fish and seafood (24 incidents), dairy products (15), fruit juices (12), oils and fats (12), grain products (11), honey and other natural sweeteners (10), spices and extracts (8), wine and other alcoholic beverages (7), infant formula (5), plant-based proteins (5), and other food products (28). We identified common characteristics among the incidents that may help us better evaluate and reduce the risk of EMA. These characteristics reflect the ways in which existing regulatory systems or testing methodologies were inadequate for detecting EMA and how novel detection methods and other deterrence strategies can be deployed. Prevention and detection of EMA cannot depend on traditional food safety strategies. Comprehensive food protection, as outlined by the Food Safety Modernization Act, will require innovative methods for detecting EMA and for targeting crucial resources toward the riskiest food products.

12

Uncu, O., B. Ozen, and F. Tokatli. "Mid-infrared spectroscopic detection of sunflower oil adulteration with safflower oil." Grasas y Aceites 70, no. 1 (January 28, 2019): 290. http://dx.doi.org/10.3989/gya.0579181.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

The oil industry is in need of rapid analysis techniques to differentiate mixtures of safflower-sunflower oils from pure oils. The current adulteration detection methods are generally cumbersome and detection limits are questionable. The aim of this study was to test the capability of a mid-infrared spectroscopic method to detect the adulteration of sunflower oil with safflower oil compared to fatty acid analysis. Mid-infrared spectra of pure oils and their mixtures at the 10–60% range were obtained at 4000–650 cm-1 wavenumber and fatty acid profiles were determined. Data were analyzed by multivariate statistical analysis techniques. The lowest level of detection was obtained with mid-infrared spectroscopy at 30% while the fatty acid profile could determine adulteration at around 60%. Adulteration levels were predicted successfully using PLS regression analysis of infrared data with R2 (calibration) = 0.96 and R2 (validation) = 0.93. As a rapid and minimum waste generating technique, mid-infrared spectroscopy could be a useful tool for the screening of raw material to detect safflower-sunflower oil mixtures.

13

Barai, B. K., R. R. Nayak, R. S. Singhal, and P. R. Kulkarni. "Approaches to the detection of meat adulteration." Trends in Food Science & Technology 3 (January 1992): 69–72. http://dx.doi.org/10.1016/0924-2244(92)90133-h.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

14

Fengou, Lemonia-Christina, Alexandra Lianou, Panagiοtis Tsakanikas, Fady Mohareb, and George-John E. Nychas. "Detection of Meat Adulteration Using Spectroscopy-Based Sensors." Foods 10, no. 4 (April 15, 2021): 861. http://dx.doi.org/10.3390/foods10040861.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Minced meat is a vulnerable to adulteration food commodity because species- and/or tissue-specific morphological characteristics cannot be easily identified. Hence, the economically motivated adulteration of minced meat is rather likely to be practiced. The objective of this work was to assess the potential of spectroscopy-based sensors in detecting fraudulent minced meat substitution, specifically of (i) beef with bovine offal and (ii) pork with chicken (and vice versa) both in fresh and frozen-thawed samples. For each case, meat pieces were minced and mixed so that different levels of adulteration with a 25% increment were achieved while two categories of pure meat also were considered. From each level of adulteration, six different samples were prepared. In total, 120 samples were subjected to visible (Vis) and fluorescence (Fluo) spectra and multispectral image (MSI) acquisition. Support Vector Machine classification models were developed and evaluated. The MSI-based models outperformed the ones based on the other sensors with accuracy scores varying from 87% to 100%. The Vis-based models followed in terms of accuracy with attained scores varying from 57% to 97% while the lowest performance was demonstrated by the Fluo-based models. Overall, spectroscopic data hold a considerable potential for the detection and quantification of minced meat adulteration, which, however, appears to be sensor-specific.

15

Ellis, David I., Victoria L. Brewster, Warwick B. Dunn, J. William Allwood, Alexander P. Golovanov, and Royston Goodacre. "Fingerprinting food: current technologies for the detection of food adulteration and contamination." Chemical Society Reviews 41, no. 17 (2012): 5706. http://dx.doi.org/10.1039/c2cs35138b.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

16

Suryawan, G. Y., I. W. Suardana, and I. N. Wandia. "Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia." May-2020 13, no. 5 (2020): 905–8. http://dx.doi.org/10.14202/vetworld.2020.905-908.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Background and Aim: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs. Materials and Methods: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3. Results: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs. Conclusion: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia.

17

MOLINA, ELENA, LOURDES AMIGO, and MERCEDES RAMOS. "Detection of Bovine Milk Proteins in Soymilk by Western Blotting." Journal of Food Protection 61, no. 12 (December 1, 1998): 1691–94. http://dx.doi.org/10.4315/0362-028x-61.12.1691.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

A Western blotting method for the detection of whey milk proteins in commercial soymilks was applied to assess the food safety. Soy proteins and milk proteins were separated by SDS-PAGE in PhastSystem equipment. After the electrophoretic separation, immunodetection with anti-bovine α-lactalbumin and anti-bovine β-lactoglobulin antisera was performed. Adulteration with bovine protein in percentages of 0.1% in soy protein can be detected. Western blotting of bovine α-lactalbumin and bovine β-lactoglobulin was applied to detect adulteration by bovine milk proteins in different soymilks: powdered soymilk and soy infant formulas.

18

El Sheikha, Aly Farag. "DNAFoil: Novel technology for the rapid detection of food adulteration." Trends in Food Science & Technology 86 (April 2019): 544–52. http://dx.doi.org/10.1016/j.tifs.2018.11.012.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

19

Karuppuswami, Saranraj, Amanpreet Kaur, Harikrishnan Arangali, and Premjeet Prem Chahal. "A Hybrid Magnetoelastic Wireless Sensor for Detection of Food Adulteration." IEEE Sensors Journal 17, no. 6 (March 15, 2017): 1706–14. http://dx.doi.org/10.1109/jsen.2017.2656476.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

20

Liu, T., T. M. Olajide, W. Wang, Z. Cheng, Q. Cheng, and X. C. Weng. "Quality detection of tea oil by 19F NMR and 1H NMR." Grasas y Aceites 72, no. 3 (September 24, 2021): e426. http://dx.doi.org/10.3989/gya.0662201.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

The nuclear magnetic resonance (NMR) technique was applied to monitor the quality of tea oil herein. The adulteration of virgin tea oil was monitored by 19F NMR and 1H NMR. The 19F NMR technique was used as a new method to detect the changes in quality and hydroperoxide value of tea oil. The research demonstrates that 19F NMR and 1H NMR can quickly detect adulteration in tea oil. High temperature caused a decrease in the ratio D and increase in the total diglyceride content. Some new peaks belonging to the derivatives of hydroperoxides appeared at δ-108.21 and δ-109.05 ppm on the 19F NMR spectrum when the oil was autoxidized and became larger when the hydroperoxide value increased. These results have great significance in monitoring the moisture content, freshness and oxidation status of oils and in detecting adulteration in high priced edible oils by mixing with cheap oils.

21

Tingting, Sun, Han Fei, Xu Yunhui, and Xu Yanhong. "A Novel Detection Method for Appetite Suppressants Illegally Added into Weight-Loss-Friendly Foods." Current Topics in Nutraceutical Research 17, no. 3 (March 23, 2019): 254–59. http://dx.doi.org/10.37290/ctnr2641-452x.17:254-259.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Weight-loss-friendly foods are often adulterated illegally with appetite suppressants. Therefore, there is an urgent need for effective and reliable methods for the detection of food adulteration. To this end, we have developed a novel detection system called high-performance liquid chromatography-tandem quadrupole time of flight mass spectrometry capable of separation and detection of adulterants as low as 0.03 μg/kg. This method describes all the necessary separation and detection parameters required for the high-throughput detection of simultaneously added multiple suppressants in foods.

22

Olajide, Mustapha Aliru, Adepoju Adenike Rashidat, and Fadipe Victor Olugbenga. "A rapid reversed-phase thin layer chromatographic detection protocol for adulteration in some edible fats and oils food formulation." Nigerian Journal of Technological Research 16, no. 2 (May 24, 2021): 48–51. http://dx.doi.org/10.4314/njtr.v16i2.8.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

The problems of adulteration in the vegetable oil and fat have been the major draw backs in the food products formulation, in spite of the various adulteration detection methods in different applications that have been reported. However, the detection tools that can be fast and reliable for the routine analysis necessitated the current work. The two groups of three different samples: vegetable fat containing sample (Blue Band, Golden Penny, La Prairie Classic) and animal fat containing samples (Kell Salad Cream, Crosse & Blackwell and Nola) was used for the purity check using the reversed phased - thin layer chromatographic (RPTLC) method of analysis were developed. The average Rf ratio of 0.95 and 0.92, found for the vegetable and animal fat groups were reported, respectively. The Rf = 0.03 difference between the two groups indicated the presence of sistosterol (plant sterol) and cholesterol (animal sterol), an improvement over color detection methods to screen oils and fats to ascertain purity. Keywords: Sistosterol, Cholesterol, Adulteration, Animal fat, Vegetable oil

23

Streza, M., D. Dadarlat, C. Socaciu, C. Bele, F. Dulf, and V. Simon. "Photopyroelectric Detection of Vegetable Oils' Adulteration." Food Biophysics 4, no. 3 (May 6, 2009): 147–50. http://dx.doi.org/10.1007/s11483-009-9111-1.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

24

Dasenaki, Marilena E., Sofia K. Drakopoulou, Reza Aalizadeh, and Nikolaos S. Thomaidis. "Targeted and Untargeted Metabolomics as an Enhanced Tool for the Detection of Pomegranate Juice Adulteration." Foods 8, no. 6 (June 14, 2019): 212. http://dx.doi.org/10.3390/foods8060212.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Pomegranate juice is one of the most popular fruit juices, is well-known as a “superfood”, and plays an important role in healthy diets. Due to its constantly growing demand and high value, pomegranate juice is often targeted for adulteration, especially with cheaper substitutes such as apple and red grape juice. In the present study, the potential of applying a metabolomics approach to trace pomegranate juice adulteration was investigated. A novel methodology based on high-resolution mass spectrometric analysis was developed using targeted and untargeted screening strategies to discover potential biomarkers for the reliable detection of pomegranate juice adulteration from apple and red grape juice. Robust classification and prediction models were built with the use of unsupervised and supervised techniques (principal component analysis (PCA) and partial least squares discriminant analysis (PLS-DA)), which were able to distinguish pomegranate juice adulteration to a level down to 1%. Characteristic m/z markers were detected, indicating pomegranate juice adulteration, and several marker compounds were identified. The results obtained from this study clearly demonstrate that Mass Spectrometry (MS)-based metabolomics have the potential to be used as a reliable screening tool for the rapid determination of food adulteration.

25

V., Surya. "A Qualitative Analysis of the Machine Learning Methods in Food Adultery: A Focus on Milk Adulteration Detection." Journal of Advanced Research in Dynamical and Control Systems 12, no. 7 (July 20, 2020): 543–51. http://dx.doi.org/10.5373/jardcs/v12i7/20202037.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

26

Trifković, Jelena, Filip Andrić, Petar Ristivojević, Etil Guzelmeric, and Erdem Yesilada. "Analytical Methods in Tracing Honey Authenticity." Journal of AOAC INTERNATIONAL 100, no. 4 (July 1, 2017): 827–39. http://dx.doi.org/10.5740/jaoacint.17-0142.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Abstract Honey is a precious natural product that is marketed with a wide range of nutritional and medicinal properties. However, it is also a product subjected to frequent adulteration through mislabeling and mixing with cheaper and lower-quality honeys and various sugar syrups. In that sense, honey authentication regarding its genuine botanical and geographical origins, as well as the detection of any adulteration, is essential in order to protect consumer health and to avoid competition that could create a destabilized market. Various analytical techniques have been developed to detect adulterations in honey, including measuring the ratios of stable isotopes (mostly 13C/12C) and the use of different spectroscopic, chromatographic, and electrochemical methods. This review aims to provide a cross-section of contemporary analytical methods used for the determination of honey authenticity in order to help the scientific community engaged in the field of honey chemistry make appropriate choices and select the best applications that should lead to improvements in the detection and elimination of fraudulent practices in honey manufacturing.

27

Poonia, Amrita, Alok Jha, Rajan Sharma, Harikesh Bahadur Singh, Ashwini Kumar Rai, and Nitya Sharma. "Detection of adulteration in milk: A review." International Journal of Dairy Technology 70, no. 1 (November 4, 2016): 23–42. http://dx.doi.org/10.1111/1471-0307.12274.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

28

Dusold, Laurence R., and John A. G. Roach. "Computer Assistance in Food Analysis." Journal of AOAC INTERNATIONAL 69, no. 5 (September 1, 1986): 754–56. http://dx.doi.org/10.1093/jaoac/69.5.754.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Abstract Laboratory computer links are a key part of acquisition, movement, and interpretation of certain types of data. Remote information retrieval from databases such as the Chemical Information System provides the analyst with structural and toxicologicai information via a laboratory terminal. Remote processing of laboratory data by large computers permits the application of pattern recognition techniques to the solution of complex multivariate problems such as the detection of food adulteration.

29

BANIA, JACEK, MACIEJ UGORSKI, ANTONI POLANOWSKI, and ERYK ADAMCZYK. "Application of polymerase chain reaction for detection of goats' milk adulteration by milk of cow." Journal of Dairy Research 68, no. 2 (May 2001): 333–36. http://dx.doi.org/10.1017/s0022029901004708.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Numerous methods based on DNA analysis have been employed in the food industry to monitor adulterations of food products of animal origin. Among them the most frequently used are: polymerase chain reaction (PCR) amplification of a marker gene fragment(s) with universal primers, or amplification of DNA with species-specific primers. PCR-products of different origin can be discriminated by size, restriction fragment length polymorphism (RFLP) or single stranded conformational polymorphism (SSCP) analysis. These methods have been used for identification, and differentiation between, the animal origins of raw or heat-treated meat and meat products (Chikuni et al. 1994; Meyer et al. 1994, 1995; Zehner et al. 1998; Behrens et al. 1999; Guoli et al. 1999; Hopwood et al. 1999; Matsunaga et al. 1999; Wolf et al. 1999). These approaches are also applicable to the analysis of dairy products. However, adulterations of goats' milk and its products are traditionally tested by immunological and/or electrophoretic methods (Amigo et al. 1992; Levieux & Venien, 1994; Mimmo & Pagani, 1998). So far, only a few DNA-based techniques designed to detect the presence of bovine DNA in goats' milk have been described (Plath et al. 1997; Branciari et al. 2000). This paper presents a one-step PCR procedure for detection of adulteration of goats' milk with cows' milk. The method, employing bovine-specific primers for amplification of a 274 bp fragment of cytochrome b DNA, seems to be simple, fast, specific and sensitive.

30

Rodriguez-Saona, L. E., and M. E. Allendorf. "Use of FTIR for Rapid Authentication and Detection of Adulteration of Food." Annual Review of Food Science and Technology 2, no. 1 (April 10, 2011): 467–83. http://dx.doi.org/10.1146/annurev-food-022510-133750.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

31

Windarsih, Anjar, Abdul Rohman, Irnawati, and Sugeng Riyanto. "The Combination of Vibrational Spectroscopy and Chemometrics for Analysis of Milk Products Adulteration." International Journal of Food Science 2021 (June 29, 2021): 1–15. http://dx.doi.org/10.1155/2021/8853358.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Milk products obtained from cow, goat, buffalo, sheep, and camel as well as fermented forms such as cheese, yogurt, kefir, and butter are in a category of the most nutritious foods due to their high contents of high protein contributing to total daily energy intake. For certain reasons, high price milk products may be adulterated with low-quality ones or with foreign substances such as melamine and formalin which are added into them; therefore, a comprehensive review on analytical methods capable of detecting milk adulteration is needed. The objective of this narrative review is to highlight the use of vibrational spectroscopies (near infrared, mid infrared, and Raman) combined with multivariate analysis for authentication of milk products. Articles, conference reports, and abstracts from several databases including Scopus, PubMed, Web of Science, and Google Scholar were used in this review. By selecting the correct conditions (spectral treatment, normal versus derivative spectra at wavenumbers region, and chemometrics techniques), vibrational spectroscopy is a rapid and powerful analytical technique for detection of milk adulteration. This review can give comprehensive information for selecting vibrational spectroscopic methods combined with chemometrics techniques for screening the adulteration practice of milk products.

32

Roosmayanti, F., K. Rismiwindira, and R. E. Masithoh. "Detection of coconut (Cocos nucivera) sugar adulteration in palm (Arenga pinnata Merrill) sugar by Fourier Transform Infrared (FT-IR) Spectroscopy." Food Research 5, S2 (June 20, 2021): 31–36. http://dx.doi.org/10.26656/fr.2017.5(s2).013.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Palm sugar which is also named brown sugar is powdered sugar produced from palm extract. Due to the high price of palm sugar, its contamination of materials that are cheap or low quality is inevitable. Usually, adulteration detection is done by conventional methods such as HPLC, TLC, or NMR which are time-consuming and require high-priced equipment, thus impractical for routine and large sample analysis. The aim of this research was to detect adulteration in palm sugar using Fourier Transform Infrared (FT-IR) spectroscopy. The samples used in this study were palm sugar as the main ingredient and coconut sugar as the adulterant. Two chemometric methods namely principal component analysis (PCA) and partial least squares regression (PLSR) were used for analysis. The absorbance data were taken at wavenumber 4000-650 cm-1 . Several concentrations of coconut sugar as an adulterant ranging from 0 to 100% were added to palm sugar. A total of 110 spectra of both pure and adulterated palm sugar samples were divided into two groups, i.e. 73 samples for developing calibration model and 37 samples for developing prediction model. The spectral obtained were pre-processed and analyzed using The Unscrambler X version 10.4. a total of six pre-processing methods were used, i.e., Normalization, Standard Normal Variate (SNV), Multiplicative Scatter Correction (MSC), and Baseline. Results showed that PCA was able to classify palm sugar based on adulterant concentrations. PLSR calibration model with a coefficient of determination (Rc2 ) of 0.94 and root mean square error of calibration (RMSEC) of 8% was obtained by applying the MSC method. The model was able to predict coconut sugar adulteration in palm sugar with Rp2 of 0.89 and root mean square error of prediction (RMSEP) of 10.68%. The results confirmed the potential of FT-IR spectroscopy for detecting adulteration in palm sugar.

33

Li-Chan, Eunice. "Developments in the detection of adulteration of olive oil." Trends in Food Science & Technology 5, no. 1 (January 1994): 3–11. http://dx.doi.org/10.1016/0924-2244(94)90042-6.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

34

Osman, Ahmed Galal, Vijayasankar Raman, Saqlain Haider, Zulfiqar Ali, Amar G. Chittiboyina, and Ikhlas A. Khan. "Overview of Analytical Tools for the Identification of Adulterants in Commonly Traded Herbs and Spices." Journal of AOAC INTERNATIONAL 102, no. 2 (March 1, 2019): 376–85. http://dx.doi.org/10.5740/jaoacint.18-0389.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Abstract Background: Spices and aromatic herbs have long been used by people to impart sensory appetizing elements, including aroma, flavor, and color, to foods and beverages in an effort to enhance their palatability. Herbs and spices exhibit a plethora of medicinal properties including antimicrobial and antioxidant properties. Spices serve as natural preservatives to delay food spoilage and extend shelf life. As spice trading has exponentially increased globally, herbs and spices have become prone to adulteration, which can be deliberate or unintentional. Deliberate adulteration is usually economically motivated, aimed at maximizing profit margins, whereas unintentional adulteration is often attributed to improper harvesting or processing of the plant material or collecting/substituting closely related species. Adulteration of herbs or spices with toxic ingredients such as Sudan dyes or metal salts (e.g., leadchromate) may result in serious public health consequences. Objective: To provide a concise account of ongoing adulteration issues with spices and herbs in order to enhance general awareness of the short- and longer-term implications of such fraud. Method: Last twenty-years of literature on various aspects of spice adulteration including text books and online resources were gathered and compiled. In addition, a number of original reports have been published prior to year 2000 that are directly associated with adulteration of commonly traded herbs and spices were also included. Results: The current review covers the role of spices and herbs in human life, adulteration of the commonly consumed spices and herbs, identification of their adulterants, as well as the most popular analytical techniques and methods used in their detection, including spectroscopic, chromatographic, electronic sensing, and deoxyribonucleic acid–based methodologies. Conclusions: Spices and herbs, being high-priced commodities, have been often subjected to adulteration in many ways which reduces their quality and potentially has harmful health implications. Adulteration is attributed primarily to increased demand or supply shortage of the spices and aromatic herbs. The motivation for spice fraud is largely attributed to economical interest to gain greater profit margins and such adulteration of spices can have serious implications for public health. To combat the adulteration of spices and herbs effectively, a range of analytical techniques across many different technologies have been developed. These techniques are expected to aid in the detection of adulterants and establish quantifiable concentrations for the compounds in question in various matrices, including spices and aromatic herbs.

35

Thienes, Cortlandt P., Jongkit Masiri, Lora A. Benoit, Brianda Barrios-Lopez, Santosh A. Samuel, Richard A. Krebs, David P. Cox, Anatoly P. Dobritsa, Cesar Nadala, and Mansour Samadpour. "Quantitative Detection of Beef Contamination in Cooked Meat Products by ELISA." Journal of AOAC INTERNATIONAL 102, no. 3 (May 1, 2019): 898–902. http://dx.doi.org/10.5740/jaoacint.18-0193.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Abstract Background: Concerns about the contamination of meat products with undeclared meats, and new regulations for the declaration of meat adulterants have established the need for a rapid test to detect beef adulteration to 0.1% sensitivity. Objective: To address this need, Microbiologique, Inc. has developed an ELISA that can quantify the presence of beef down to 0.1% (w/w) in cooked pork, horse, chicken, goat, and sheep meat. Results: The beef-authentication ELISA has an analytical sensitivity of 0.00022 and 0.00012% (w/v) for cooked and autoclaved beef, respectively, and an analytical range of quantitation of 0.025 to 2% (w/v), in the absence of other meats. Moreover, the assay is specific for cooked beef and does not cross react with common food matrixes. Conclusions: The assay is rapid, can be completed in 70 min, and can detect a 0.1% level of meat adulteration. The assay is an improvement over a previous U.S. Department of Agriculture’s tested assay, which is sensitive to 1% adulteration and takes 2.5–3 h to complete. Highlights: The Microbiologique Cooked Beef ELISA can quantitate cooked beef in the presence of pork, horse, chicken, goat, and sheep meat to 0.1% (w/w) and is not affected by common food matrixes.

36

Choudhary, Ankita, Neeraj Gupta, Fozia Hameed, and Skarma Choton. "An overview of food adulteration: Concept, sources, impact, challenges and detection." International Journal of Chemical Studies 8, no. 1 (January 1, 2020): 2564–73. http://dx.doi.org/10.22271/chemi.2020.v8.i1am.8655.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

37

Cordella, Christophe, Issam Moussa, Anne-Claire Martel, Nicolas Sbirrazzuoli, and Louisette Lizzani-Cuvelier. "Recent Developments in Food Characterization and Adulteration Detection: Technique-Oriented Perspectives." Journal of Agricultural and Food Chemistry 50, no. 7 (March 2002): 1751–64. http://dx.doi.org/10.1021/jf011096z.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

38

Mohammadi, Zahra, and Seid Mahdi Jafari. "Detection of food spoilage and adulteration by novel nanomaterial-based sensors." Advances in Colloid and Interface Science 286 (December 2020): 102297. http://dx.doi.org/10.1016/j.cis.2020.102297.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

39

Hong, Eunyoung, Sang Yoo Lee, Jae Yun Jeong, Jung Min Park, Byung Hee Kim, Kisung Kwon, and Hyang Sook Chun. "Modern analytical methods for the detection of food fraud and adulteration by food category." Journal of the Science of Food and Agriculture 97, no. 12 (May 24, 2017): 3877–96. http://dx.doi.org/10.1002/jsfa.8364.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

40

Ellis, David I., Victoria L. Brewster, Warwick B. Dunn, J. William Allwood, Alexander P. Golovanov, and Royston Goodacre. "ChemInform Abstract: Fingerprinting Food: Current Technologies for the Detection of Food Adulteration and Contamination." ChemInform 43, no. 45 (October 11, 2012): no. http://dx.doi.org/10.1002/chin.201245273.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

41

Şimşek, Atilla, Nevzat Artık, and Ensar Baspinar. "Detection of raisin concentrate (Pekmez) adulteration by regression analysis method." Journal of Food Composition and Analysis 17, no. 2 (April 2004): 155–63. http://dx.doi.org/10.1016/s0889-1575(03)00105-4.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

42

Galvin-King, Pamela, Simon A. Haughey, and Christopher T. Elliott. "Garlic adulteration detection using NIR and FTIR spectroscopy and chemometrics." Journal of Food Composition and Analysis 96 (March 2021): 103757. http://dx.doi.org/10.1016/j.jfca.2020.103757.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

43

Won, Se-Ra, Deug-Chan Lee, Seuk Hyun Ko, Jang-Won Kim, and Hae-Ik Rhee. "Honey major protein characterization and its application to adulteration detection." Food Research International 41, no. 10 (December 2008): 952–56. http://dx.doi.org/10.1016/j.foodres.2008.07.014.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

44

Ettalibi, Fatima, Abderraouf El Antari, Chemseddoha Gadhi, and Hasnaâ Harrak. "Oxidative Stability at Different Storage Conditions and Adulteration Detection of Prickly Pear Seeds Oil." Journal of Food Quality 2020 (September 30, 2020): 1–12. http://dx.doi.org/10.1155/2020/8837090.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Lipid oxidation and adulteration have a negative impact on functionality and notoriety of foods especially vegetable oils and cause economic losses. The present study investigates the control of two commercial quality aspects of prickly pear seeds oil (PPSO): oxidative stability during storage and detection of adulteration. Peroxide index, specific extinction coefficients K232 and K270, free acidity, and fatty acids composition were evaluated during different periods of incubation (6, 12, and 18 months) at various temperatures (4°C, 25°C, 40°C, and uncontrolled room temperature ranging between 4°C and 40°C) with different packaging (protected and unprotected from sunlight, with and without nitrogen gas bubbling). Based on the physicochemical and biochemical parameters evolution, this study has shown that PPSO stored at 4°C for 18 months preserves the initial quality. However, at 40°C, an intense lipid oxidative process occurred after 6 months of storage. The changes have also affected fatty acids composition, especially rates of linoleic and oleic acids. The shelf-life of oils stored at 25°C and at uncontrolled room temperature can be limited to 6 months. Regarding the impact of light and nitrogen bubbling, sunlight has affected seriously the oxidative stability of oils after 12 months of storage and the bubbling with nitrogen has improved their stability when they have been stored in clear glass bottles. The levels of adulteration detection using fatty acids as markers are relatively high. The detection of oil adulteration can be depicted by fatty acids composition up to 15% of olive and almond oils and up to 20% of rapeseed oil. The iodine value could also be an indicator of the sunflower oil presence in PPSO. Therefore, other minor compounds including sterols and tocopherols should be investigated to depict PPSO adulteration with cheaper oils and to determine lower levels of detection in order to ensure the authenticity of PPSO.

45

Ellis, David I., Howbeer Muhamadali, Simon A. Haughey, Christopher T. Elliott, and Royston Goodacre. "Point-and-shoot: rapid quantitative detection methods for on-site food fraud analysis – moving out of the laboratory and into the food supply chain." Analytical Methods 7, no. 22 (2015): 9401–14. http://dx.doi.org/10.1039/c5ay02048d.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Major food adulteration and contamination events occur with alarming regularity and are known to be episodic, with the question being not if but when another large-scale food safety/integrity incident will occur.

46

BURDA, KATARINA, and MICHAEL COLLINS. "Adulteration of Wine with Sorbitol and Apple Juice." Journal of Food Protection 54, no. 5 (May 1, 1991): 381–82. http://dx.doi.org/10.4315/0362-028x-54.5.381.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

One hundred and thirty-nine Australian wines, including white and red wines, port, sherry and muscat, were analyzed for sorbitol and chlorogenic acid in connection with the adulteration of wine with sorbitol and apple juice, respectively. Sorbitol was found in 10 wines in the range 3.4–6.7 g/L, well above the likely natural level of 0.1–1.0 g/L. The detection limit for sorbitol was 0.1 mg/L. In a further five wines, chlorogenic acid was found in the range 10–31 mg/L. The natural occurrence of chlorogenic acid in wine is <2 mg/L. The detection limit for chlorogenic acid in white and red wines was 0.5 mg/L and 1.0 mg/L, respectively.

47

Sugiana, Fenny Aulia, Henni Widyowati, Muhammad Ali Warisman, Suryani Suryani, and Desriani Desriani. "Low cost and comprehensive pork detection in processed food products with a different food matrix." Indonesian Journal of Biotechnology 23, no. 1 (June 11, 2018): 21. http://dx.doi.org/10.22146/ijbiotech.32372.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

The adulteration of processed beef-based meat products with pork is a sensitive issue in Indonesia. In this study, we developed a detection method for the low cost identification of pork in processed meat products. We used the cost-efficient Taq DNA polymerase, DreamTaq Green PCR master mix (2x), and duplex PCR method to recognize pork simultaneously with 18S rRNA detection. A positive control containing a pork gene inserted into pGEM®-T easy was prepared, along with a negative control. The results of the duplex PCR were used to assess its specificity, detection limit, and its ability to recognize pork in processed meat products with a different food matrix. 18S rRNA detection was for confirming DNA integrity of DNA extracted from the processed food, while the positive control confirmed that the reagents were working well and the negative control confirmed a non-contamination problem. Following this, the duplex PCR was optimized and the optimum concentration primer for duplex PCR detection was found to be 3 µm for pork and 0.2 µm for 18S rRNA. As little as 3.125 ng of the DNA template could be used to detect whether a sample contained pork. Duplex PCR is a simple, fast, sensitive, specific, and low cost method of detecting pork in processed meat products.

48

Trivedi, Drupad K., Katherine A. Hollywood, Nicholas J. W. Rattray, Holli Ward, Dakshat K. Trivedi, Joseph Greenwood, David I. Ellis, and Royston Goodacre. "Meat, the metabolites: an integrated metabolite profiling and lipidomics approach for the detection of the adulteration of beef with pork." Analyst 141, no. 7 (2016): 2155–64. http://dx.doi.org/10.1039/c6an00108d.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

49

Sheppard, A. J., C. S. J. Shen, and T. S. Rudolf. "Detection of Vegetable Oil Adulteration in Ice Cream." Journal of Dairy Science 68, no. 5 (May 1985): 1103–8. http://dx.doi.org/10.3168/jds.s0022-0302(85)80935-8.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

50

Power, Aoife C., Caoimhe Ní Néill, Sive Geoghegan, Sinéad Currivan, Mary Deasy, and Daniel Cozzolino. "A Brief History of Whiskey Adulteration and the Role of Spectroscopy Combined with Chemometrics in the Detection of Modern Whiskey Fraud." Beverages 6, no. 3 (August 3, 2020): 49. http://dx.doi.org/10.3390/beverages6030049.

Повний текст джерела

Стилі APA, Harvard, Vancouver, ISO та ін.

Анотація:

Food fraud and adulteration is a major concern in terms of economic and public health. Multivariate methods combined with spectroscopic techniques have shown promise as a novel analytical strategy for addressing issues related to food fraud that cannot be solved by the analysis of one variable, particularly in complex matrices such distilled beverages. This review describes and discusses different aspects of whisky production, and recent developments of laboratory, in field and high throughput analysis. In particular, recent applications detailing the use of vibrational spectroscopy techniques combined with data analytical methods used to not only distinguish between brand and origin of whisky but to also detect adulteration are presented.